Tải bản đầy đủ - 0 (trang)
CHƯƠNG 2: ĐỐI TƯỢNG,VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

CHƯƠNG 2: ĐỐI TƯỢNG,VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ - 0trang

gentamicin   (GM),   amikacin   (AK)   và   colistin   (CS).   Chủng   chuẩn   quốc   tế:  

Escherichia coli ATCC­25922 được tiến hành song song với các chủng vi khuẩn 

thử nghiệm [20].

Sau khi thực hiện thử nghiệm, các chủng vi khuẩn kháng với carbapenem 

sẽ  được ghi lại, lập danh sách cụ  thể  và gửi về  phòng thí nghiệm Kháng sinh­  

Khoa Vi khuẩn­Viện Vệ sinh Dịch tễ Trung  ương để tiếp tục thực hiện các thử 

nghiệm tiếp theo phục vụ cho nghiên cứu.



2.6.1.2.



Kỹ   thuật   xác   định   nồng   độ   kháng   sinh   tối   thiểu   ức   chế   vi  

khuẩn (MIC)

Kỹ thuật MIC được thực hiện tại phòng thí nghiệm Kháng sinh­ Khoa Vi  

khuẩn­Viện Vệ sinh Dịch tễ Trung  ương. Các chủng vi khuẩn thử nghiệm được 

ni cấy trên các đĩa thạch Mueller­hinton có nồng độ kháng sinh khác nhau theo  

tiêu chuẩn của CLSI và được ủ ở 37oC qua đêm (khoảng 18 giờ). Nồng độ kháng 

sinh tối thiểu có tác dụng ức chế vi khuẩn được xác định khi mật độ  khuẩn lạc  

  3. Các kháng sinh được thử  nghiệm bao gồm imipenem (IMP), meropenem  

(MEM),   ceftazidime   (CAZ),   cefotaxime   (CTX),   ciprofloxacin   (CIP),   gentamicin 

(GM), amikacin (AK) và colistin (CS). Chủng chuẩn quốc tế:   Escherichia coli 

ATCC­25922 được tiến hành song song với các chủng vi khuẩn thử nghiệm [20].



2.6.2. Các kỹ thuật sinh học phân tử

2.6.2.1.

Kỹ thuật PCR phát hiện vi khuẩn mang gen NDM­1



Tế  bào vi khuẩn ly giải tồn phần trong nước cất vơ trùng bằng phương 



pháp tách nhiệt  ở 95oC trong 10 phút, ly tâm loại bỏ  cặn và giữ  lại nước nổi có 

chứa DNA để  sử  dụng làm khn mẫu cho kỹ  thuật PCR phát hiện các gen  

NDM­1.Các đoạn mồi sử dụng cho kỹ thuật được trình bày tại Bảng 2.1.



39



Bảng 2.1:  Trình tự mồi để phát hiện gen NDM­1 của vi khuẩn [79]

TT Tên



Trình tự mồi



Ndm1­F



5’­atgcacccggtcgcgaagctgag­3’



Ndm1­R



5’­ttcgacccagccattggcggcga­3’



Kích 

thước 

(bp)

499



Quy trình tách chiết DNA của vi khuẩn: Vi khuẩn được xác định là chủng  

thuần và được ni cấy trên mơi trường thạch dinh dưỡng. Lấy 3­5 khuẩn lạc vi  

khuẩn, hòa đều vào 200µl nước cất vơ trùng đựng trong tube ly tâm vơ trùng. Đun 

cách thủy  ở 95oC/ 5 phút sau đó ly tâm 13.000 vòng/ 10 phút và loại bỏ  cặn, thu  

nước nổi làm khn mẫu DNA cho phản ứng PCR.

Sản phẩm PCR sẽ được điện di trên thạch điện di agarose nồng độ  1,5% 

trong đệm TAE 1X trong 30 phút. Sau khi điện di xong gel được nhuộm trong  

dung dịch ethidium bromine  nồng độ 10mg/ml trong 10 phút, rửa trong nước cất 

15 phút.

Gel được mang đi quan sát và chụp lại bằng máy chụp ảnh gel.

Phân tích kết quả: Sau khi thu được  ảnh chụp, các chủng vi khuẩn xuất 

hiện band sẽ  được so sánh với kích thước band của chứng dương để  kết luận 

chúng có dương tính với gen NDM­1 hay khơng.



2.6.2.2.



Phân   tích   đặc   điểm   dịch   tễ   học   phân   tử   bằng   kỹ   thuật 

multilocus sequence typing (MLST)

Phương pháp của Bartual và cộng sự  sẽ  được áp dụng để  tiến hành kỹ 

thuật MLST. Trong kỹ  thuật MLST, chúng tơi sử  dụng phương pháp PCR để 

khuếch đại 7 đoạn gen bảo tồn (gltA, gyrB, gdhB, recA, cpn60, gpi và rpoD) sau 

đó tiến hành giải trình tự. Số  lượng Allele sẽ  phân loại các ST (sequence type) 

sau khi số liệu này được gửi vào dedicated data­ base (http://pubmlst.org). Các dữ 



40



liệu về  Allele của 7 đoạn gen bảo tồn (gltA, gyrB, gdhB, recA, cpn60, gpi  và 

rpoD)   sẽ   được   phân   tích   trên   cơ   sở   dữ   liệu   về   MLST   của   Acinetobacter 

baumannii



 http://pubmlst.org/perl/bigsdb/bigsdb.pl?



db=pubmlst_abaumannii_oxford_seqdef



Bảng 2.2.  Các trình tự mồi sử dụng trong kỹ thuật MLST đối với chủng A.  

baumannii [11]



TT



Tên



gltA ­F



AAT TTA CAG TGG CAC ATT AGG 

TCC C



gltA ­R



GCA GAG ATA CCA GCA GAG ATA 

CAC G



gyrB ­F



TGA AGG CGG CTT ATC TGA GT



gyrB ­R



GCT GGG TCT TTT TCC TGA CA



gdhB ­F



GCT ACT TTT ATG CAA CAG AGC C



gdhB ­R



GTT GAG TTG GCG TAT GTT GTG C



recA ­F



CCT GAA TCT TCY GGT AAA AC



recA ­R



GTT TCT GGG CTG CCA AAC ATT AC



cpn60­F



GGT GCT CAA CTT GTT CGT GA



cpn60­R



CAC CGA AAC CAG GAG CTT TA



gpi­F



GAA ATT TCC GGA GCT CAC AA



gpi­R



TCA GGA GCA ATA CCC CAC TC



rpoD ­F



ACC CGT GAA GGT GAA ATC AG



rpoD ­R



TTC AGC TGG AGC TTT AGC AAT



1



2



3



4



5



6



7



41



Trình tự mồi



Kích 

thước 

(bp)



Tài liệu 

tham khảo



772



594



774



425



640



456



672



A. baumannii 

MLST 

website



Sau khi chạy PCR với 7 cặp mồi cho kỹ thuật MLST, sản phẩm PCR s ẽ 

được mang đi tinh sạch bằng bộ kit DNA Gel purification (QIAGEN).Thực hiện  

phản ứng Bigdye – PCR

Tinh sạch sản phẩm DNA: Cho 45 µl Sam solution và 10 µl X­termination/  



­ 



mẫu bệnh phẩm. Lắc 2000 vòng/30 phút, ly tâm 3000 vòng trong 2­3 phút lấy 

nước nổi cho vào máy giải trình tự gen.

Đọc trình tự  gen bằng máy đọc trình tự  ABI­3130   (Applied Biosystem, 



­ 

Mỹ).

­ 



Phân tích trình tự  gen: So sánh các đoạn gen với các trình tự  chuẩn của  



ngân hàng gen trên website của đơn vị nghiên cứu Oxford http://pubmlst.org



2.6.2.3.



Phân tích mối liên hệ kiểu gen các chủng A. baumannii bằng kỹ 

thuật PFGE [39]

Tách DNA vi khuẩn trong đệm thạch: 



­ Lấy   một   khuẩn   lạc   của   các   chủng  A.   baumannii  và   chủng   vi   khuẩn 



Braenderup H9812 (chủng chuẩn) trên đĩa thạch Mueller­hinton được ni 

cấy qua đêm ở 37oC cấy vào ống canh thang LB, ủ ở 37oC qua đêm

­ Hút canh khuẩn vào tube ly tâm 1.5ml, ly tâm 8000vòng/phút trong 5 phút. 

Loại bỏ nước nổi, rửa cặn bằng TE 1X sau đó ly tâm 8000vòng/phút trong 

5 phút. Giữ  lại cặn và hồn ngun vào 500 µl CSB, bổ  sung protein K 

(20mg/ml) và đảo nhẹ bằng pipet.

­ Bổ  sung SGA­SDS 1% vào hỗn dịch vi khuẩn, trộn đều, sau đó nhỏ  hỗn 

dịch vào khn tạo plug, để ở nhiệt độ phòng khoảng 10­15 phút cho đơng.

­ ly giải tế  bào vi khuẩn bằng dung dịch CLB (1mg/ml protein K, 1% N­

lauroylsarcosin   trong   0.5M   EDTA   pH   8.0),   bổ   sung   30µl   proiein   K 

(20mg/ml) lắc nhẹ trong bể ủ nhiệt ở 55o C qua đêm.

Rửa plug sau khi ly giải:



­ Loại bỏ nước ly giải tế bào, rửa plug bằng nước khử  ion vơ trùng 2 lần  

mỗi lẫn 15 phút ở 55oC. Thực hiện bước rửa tương tự bằng TE 1 X sau đó 

giữ plug trong TE 1X ở 4oC tới khi sử dụng.



Cắt DNA vi khuẩn bằng enzyme cắt giới hạn:



42



­ Cắt   chromosomal   DNA   của   vi   khuẩn   đã   tách   chiết   trong   thạch   bằng  

Enzym giới hạn XbaI (đối với chủng chuẩn Braenderup H9812 ) và ApaI 

(cho  A. baumannii) nồng độ  30UI/ miếng thạch  ở  37 0C trong vòng 12­16 

giờ. 

­ Sản phẩm cắt DNA sẽ được điện di bằng bộ điện di CHEF­DR III (Bio­

Rad laboratories, Richmond, Calif) trên thạch Seakem gold 1%, ở hiệu điện 

thế 6V/cm trong 19 giờ ở nhiệt độ 140C, thời gian một xung từ 25 đến 60s 

và góc điện trường là 120 độ. 

2.6.2.4.

Phát hiện plasmid mang gen NDM­1 bằng kỹ  thuật Southern­

Blotting [39]

Tạo mẫu dò cho gen NDM­1:



­ Khuếch đại đoạn gen NDM­1 bằng phản ứng PCR.

­ Tinh   sạch   sản   phẩm   PCR   bằng   tinh   sach   DNA   (high   pure   product  



purification kik – Roche)

­ Biến tính 100 ng DNA  ở 100oC trong 5 phút sau đó làm lạnh tức thì bằng 

cách vùi vào đá dắm trong 10 phút.

­ Tạo mẫu dò bằng bộ kít ECLTM Amersham

­ Sản phẩm NDM­1 sau khi đánh dấu nếu khơng sử dụng ngay có thể được 

giữ ở trong 30% glycerol ở ­15 đến ­300C trong 6 tháng.

Tách chiết DNA vi khuẩn trong đệm thạch (giống với phương pháp PFGE ở  

phần 2.6.2.3)

Thực hiện kỹ thuật S1­PFGE:



­ Cắt loại bỏ  DNA nhiễm sắc thể  của vi khuẩn bằng enzym S1 nồng độ 



20UI/200µl dung dịch đệm enzym S1, Ủ 370C trong 1 giờ.

­ Chủng  S.   braenderup  H9812   sử   dụng   làm   thang   DNA   chuẩn   được   cắt 

bằng enzym XbaI, 30UI/phản ứng ở 370C trong 3 giờ.

­ Sản phẩm cắt DNA sẽ được điện di bằng bộ điện di CHEF­DR III (Bio­

Rad laboratories, Richmond, Calif) trên thạch Seakem gold 1%    để  tách 

plasmid.

­ Nhuộm gel trong dung dịch ethidium bromide và chụp  ảnh để  xác định số 

lượng và kích thước plasmid của các chủng vi khuẩn.

Chuyển DNA plasmid sang màng lai Hybond­N, Amersham:



­ Rửa gel bằng dung dịch HCL 0,25M lạnh trong 7 phút, dung dịch biến tính 

­



43



(NaCl 1,5M; NaOH 0,5M) lạnh trong 20 phút và dung dịch trung hòa (Tris­

HCl 0,5M; NaCl 1,5M; pH 7.5) lạnh trong 20 phút.

Chuyển các plasmid sang màng lai Hybond­N của hãng Amersham bằng  

dung dịch chuyển màng SSC 20X (3 M NaCl, 300 mM Natri Citrate, pH 7.0)  



bằng hệ  thống chuyển màng Biometra­analytic (của hãng Jena, Cộng hòa 

Pháp).

Thực hiện phản ứng lai:



­ Màng lai đặt ủ trong dung dịch tiền lai (gold hydridization buffer của hãng 

ECLTM Amersham)  ở 42oC trong 1 giờ.

­ Loại bỏ  dung dịch tiền lai đưa vào dung dịch lai đã được bổ  sung 30 µl 

mẫu dò NDM­1. 

­ Lai qua đêm ở 42oC (khoảng 16 giờ) bằng lò lai UPV HL­2000 HybriLinker 

(Đức).

­ Dừng phản  ứng lại và rửa màng lai bằng dung dịch SSC 0,5X chứa 0,4%  

SDS và dung dịch SSC 2X ở 55oC.

Hiện màng (sử dụng bộ Kit ECl, Hãng ECLTM Amersham):



­ Hiện màng trên hyper film bằng hỗn hợp detection 1 và detection 2 ECLTM 

Amersham.

Phân tích kết quả: Sử dụng ảnh chụp gen các plasmid trước khi và ảnh plasmid 

sau khi lai để phát hiện số lượng và kích thước các plasmid mang gen.

2.7.

­



Quản lý và phân tích số liệu

Số  liệu thu thập được từ  phiếu điều tra và bệnh án sẽ  được nhập 2 lần 

độc lập vào máy tính và kiểm tra đối chiếu để tránh sai sót trong q trình 

nhập số  liệu. Số  liệu được quản lý và phân tích bằng phần mềm excel.  

Kết quả được trình bày dưới dạng bảng, đồ thị, biểu đồ



­



Phần   mềm   Bioedit   và   website   của   đơn   vị   nghiên   cứu   Oxford  

http://pubmlst.org được sử dụng để đọc và phân tích kết quả MLST.



­



Phân   tích   mối   liên   hệ   kiểu   gen   của   các   chủng  A.   baumannii  kháng 

carbapenem mang gen NDM­1 bằng phần mềm Bionumeric­ 6.5 để tạo cây 

phả hệ.



44



CHƯƠNG 3: KẾT QUẢ VÀ THẢO LUẬN



3.1.



Mô tả thực trạng kháng kháng sinh của các chủng A. baumannii kháng 

carbapenem phân lập tại 3 bệnh viện Việt Đức, Thanh Nhàn, Xanh Pôn

Trong 5 năm, từ năm 2010 đến năm 2014 nghiên cứu đã thu thập được 582 

chủng A. baumannii kháng carbapenem tại 3 bệnh viện  ở Hà Nội, năm 2010 thu 

thập  được  34  chủng  A.  baumannii, năm 2011 là  220  chủng; năm 2012  là  279 

chủng; năm 2013 là 47 chủng và năm 2014 là 2 chủng. Trong đó có 55 chủng thu  

tập tại bệnh viện Xanh Pơn, 106 chủng ở bệnh viện Thanh Nhàn và 421 chủng ở 

bệnh viện Việt Đức (Hình 3.1).



250

217

200

153



ốC

S



g

n

h



150



100



50



31 36

15 14



49



35

13



5



12



0

2010



2011

Việt Đức



2012



Tha nh Nhà n



2013



0



1



0



1



2014



Xa nh Pơn



Hình 3.1. Tỷ lệ phân bố vi khuẩn A. baumannii kháng carbapenem tại 3 

bệnh viện theo năm (n=582)



Trong 582 chủng  A. baumannii  phân lập được tại 3 bệnh viện, có 428 

chủng được phát hiện  ở nam giới chiếm khoảng 74% và 154 chủng phát hiện ở 

nữ  giới chiếm khoảng 26% tổng số  trường hợp (tỷ  suất chênh Nam/nữ=2,78). 



45



Qua đó cho thấy tỷ lệ nam giới nhiễm vi khuẩn  A. baumannii kháng carbapenem 

cao hơn nữ giới rất nhiều (Hình 3.2).



26 %



154



428



Nam



74 %



Nữ



Hình 3.2. Tỷ lệ phân bố của các chủng vi khuẩn A. baumannii kháng 

carbapenem 3 bệnh viện theo giới (n=582)



Tỷ lệ về giới được thể hiện rõ hơn đối với từng bệnh viện trong biểu đồ 

tỷ  lệ  phân bố  theo giới phát hiện các chủng   A. baumannii  kháng carbapenem 

(Hình 3.3). 



46



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

CHƯƠNG 2: ĐỐI TƯỢNG,VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ ngay(0 tr)

×