Tải bản đầy đủ - 0 (trang)
- Cách 3: Xác định khả năng sinh β-galactosidase bằng phương pháp cấy ria trên đĩa thạch

- Cách 3: Xác định khả năng sinh β-galactosidase bằng phương pháp cấy ria trên đĩa thạch

Tải bản đầy đủ - 0trang

3.3.3. Xác định hoạt độ của β-galactosidase ngoại bào

Hoạt độ của β-galactosidase được xác định theo phương pháp của Nguyen và cs,

2006, được mô tả như sau:

Nguyên tắc: Hoạt độ β-galactosidase được xác định bằng cách cho enzyme này

phản ứng với cơ chất tổng hợp o-nitrophenyl-β-D-galactopyranoside (oNPG). Dưới tác

dụng của β-galactosidase, oNPG sẽ thủy phân thành galactose và o-nitrophenol. onitrophenol khi giải phóng sẽ chuyển hỗn hợp phản ứng sang màu vàng và hấp thụ

(Abs) ở bước sóng cực đại 420 nm.

- Bước 1: Xây dựng đường chuẩn oNP

Các dung dịch

1

Vdung dịch gốc (ml)

0

Vdung dịch đệm (ml)

5

Nồng độ (mM)

0

Dùng 0.5ml oNP và 0.75ml



2

3

4

5

0.1

0.2

0.3

0.4

4

3

2

1

0.4

0.8

1.2

1.6

Na 2CO3 đo ở bước sóng 420nm, dựa vào



6

0.5

0

2.0

sự tương



quan giữa nồng độ oNP và giá trị OD ở bước sóng 420nm xác định được tốc độ

phản ứng của oNP qua đường chuẩn dựng bằng phần mềm Excel.

Bảng 3.1. Số liệu dựng đường chuẩn oNP

STT

Nồng độ



1

0



2

0.04



3

0.08



4

0.12



5

0.16



6

0.2



oNP (mM)

Abs



0.0045



0.1326



0.2624



0.3878



0.5078



0.6336



Hình 3.1 Đường chuẩn oNP

- Bước 2: Xác định hoạt tính của enzyme



15



+ Hút 480 µl oNPG vào ống eppendorf 1,5ml, sau đó ống eppendorf được cho

vào máy ổn nhiệt (thermomixer) ở 30oC, chờ 5 phút để nhiệt độ trong ống eppendorf

đạt 30ºC trước khi đưa enzyme vào.

- Bắt đầu phản ứng bằng cách thêm 20 µl dung dịch enzyme ngoại bào (ở phần

3.3.1).

+ Lắc đều ở 600 vòng/phút trong 10 phút.

+ Dừng phản ứng enzyme bằng cách bổ sung 750 µl Na 2CO3 0.4 M vào trong

ống eppendorf.

+ Đo độ hấp quang trên máy so màu ở bước sóng 420 nm.

Mẫu đối chứng được tiến hành tương tự như mẫu thí nghiệm, trong đó 20 µl

dung dịch enzyme được thay thế bằng 20 µl dung dịch đệm phosphate pH 6.5.

Thí nghiệm lặp lại 2 lần, sai số ở 2 thí nghiệm khơng được vượt q 5%.

Tính kết quả:

Hoạt tính enzyme có trong 1 ml dịch nuôi cấy theo công thức sau:



Trong đó:

U/ml:

Abs420nm:



Hoạt tính β- galactosidase

Độ hấp thụ quang của phản ứng màu đo được tại



420 nm

Blank:

Độ hấp thụ quang của mẫu đối chứng

SlopeoNPstandardcurve:

Hệ số góc của đường chuẩn oNP

treaction:

Thời gian phản ứng enzyme cơ chất (phút)

3.3.4. Phương pháp tuyển chọn chủng vi khuẩn Bacillus sinh β-galactosidase

thủy phân có đặc tính chịu nhiệt

Phương pháp tuyển chọn chủng vi khuẩn sinh β-galactosidase chịu nhiệt được

xác định theo phương pháp của Nguyen và cs, 2012.

Để xác định khả năng chịu nhiệt của β-galactosidase, các enzyme này được ủ ở

nhiệt độ 60ºC. Tại các thời gian ủ khác nhau, enzyme lấy ra để xác định hoạt độ (theo

phương pháp mô tả ở mục 3.3.3). Độ bền nhiệt của enzyme được xác định bằng cách

so sánh % hoạt độ còn lại của enzyme tại thời điểm đo với thời điểm bắt đầu ủ.



16



3.3.5. Định danh chủng được tuyển chọn bằng phương pháp xác định trình tự

gen 16S rRNA

Chủng vi khuẩn sinh β-galactosidase chịu nhiệt được xác định trình tự gen và so

sánh mức độ tương đồng di truyền với các loài trên ngân hàng gen NBCI bằng công cụ

BLAST theo phương pháp của Maxam và Gibert, 1997.

3.3.5.1. Quy trình chiết DNA

- Lấy 50 – 100 µl dịch khuẩn vào tube 1.5 ml

- Dịch nuôi được ly tâm ở 5000 vòng trong 10 phút để thu sinh khối. Dùng pipet

hút cẩn thận dịch trong ra khỏi tube, giữ cặn.

- Hòa tan sinh khối trong 0.5 ml đệm (Tris-HCl, EDTA, NaCl, SDS).

- Ủ phản ứng ở nhiệt độ phòng trong 10 phút, siêu âm phá vỡ tế bào, 70% năng

lượng , 5 phút bật/ 5 phút tắt.

- Bổ sung lysozyme 20 μg/ml, ủ ở nhiệt độ 370C trong 1h.

- Bổ sung 0.15 ml CH3COOK.

- Ly tâm 10000 vòng, dùng pipet hút cẩn thận phần dịch trong bên trên (khoảng

600 µl, khơng lấy phần phân lớp).

- Bổ sung isopropanol tỉ lệ 1:1 so với thể tích dịch trong tube để kết tủa DNA.

- Lắc đều tube và để trong tủ -20ºC trong 30 phút.

- Ly tâm ở 13000 vòng trong 10 phút ở 40C để thu tủa DNA.

- Để lắng DNA, đổ dịch trong, thu DNA.

- Rửa tủa bằng cồn 70% 2 lần (mỗi lần dùng khoảng 500µl), sau đó cho vào máy spin.

- Làm khơ cặn bằng cách mở nắp tube, để trong buồng cấy vô trùng 30 phút ở

nhiệt độ phòng.

- Hòa tan DNA trong 50µl nước cất 2 lần vô trùng.

- Kiểm tra chất lượng mẫu chiết DNA bằng điện di gel agarose (dùng 1-2µl dịch DNA).

3.3.5.2. Nhân DNA bằng PCR và giải trình tự gen

- Sử dụng cặp mồi đặc hiệu đã được sử dụng quốc tế: 27F/1492R, ới trình tự:

27F:



5’AGAGTTTGATCCTGGCTCAG 3’



1492R: 5’TACGGYTACCTTGTTACGACTT 3’

- Các phản ứng PCR được thực hiện trong tube 0,5ml với tổng thể tích phản ứng

là 25µl, thành phần của mỗi phản ứng PCR gồm:

5 mM dNTPs



: 1.5 µl

17



10X Taq Buffer



: 2.5 µl



5 µM 27F



: 1 µl



5 µM 1492R



: 1 µl



DNA template



: 1 µl



Taq DNA pol



: 0.3 µl



H2 O



: 17.5 µl



Tổng thể tích phản ứng



: 25 µl



- Chu trình nhiệt

95ºC

95ºC



5 phút

45 giây



x1 vòng



56ºC



1 phút



x30 vòng



72ºC

72ºC



1 phút 30 giây

5 phút



x1vòng



3.3.5.3. Chạy điện di

* Chuẩn bị:

- Dung dịch đệm TAE 0,5x.

- Bản gel: Cân 1g agarose cho vào 100ml TAE0,5x sau đó lắc nhẹ lọ để hòa tan

agarose. Sau đó đun trong lò vi sóng 3 – 4 phút, bổ sung Ethidium Bromide theo tỷ lệ

cứ 100ml dung dịch gel cho 4µl, lắc đều, để lọ ở nhiệt độ phòng. Khi dung dịch

agarose 1% nằm trong khoảng 400C thì đổ vào khn có đặt lược khi tạo lỗ khuôn. Để

khuôn ở nhiệt độ phòng.

- Các tube chứa 0,5ml chứa các sản phẩm PCR (đã đánh số thứ tự) cho vào mỗi

tube 4µl loading Dye X6, đảo đều và spin trong 5 giây.

*Tiến hành

- Sau 30 giây để khn ở nhiệt độ phòng thì tiến hành rút lược.

- Đặt cả khay khuôn gel vào bể điện di, đổ dung dịch đệm TAE 0,5x phủ ngập gel.

- Nhỏ mẫu vào giếng: dùng pipet hút 7 - 10µl dung dịch mẫu cần chuẩn đốn cho

vào mỗi giếng theo thứ tự. Ngồi các mẫu chạy PCR còn nhỏ thêm 1 giếng marker làm

chuẩn.

- Cắm nguồn điện cho máy điện di. Đặt ở hiệu điện thế 100V trong 25 phút, tắt

máy điện di, đặt bản gel được kiểm tra dưới ánh sáng tử ngoại. Quan sát các vệt DNA

hiện lên và chụp ảnh.

3.3.5.3. Giải trình tự chuỗi 16S RNA ribosome

18



Sản phẩm PCR được tinh chiết từ gel agarose dùng kit tinh chiết PureLink TM

Quick Gel Extraction Kit (Invitrogen) theo hướng dẫn của nhà sản xuất. Sản phẩm

PCR tinh chiết được giải trình tự trực tiếp bằng mồi PCR tại hãng Firs-base, Malaysia.

3.3.5.3. Phân tích trình tự

Kết quả giải trình tự tự gene được so sánh với các trình tự gene đã được công bố

từ trước tại NCBI (The National Center for Biotechnology Information) nhờ phần

mềm tìm kiếm BLAST (http://www.ncbi.nlm.nih.gov/BLAST).

3.3.6. Tinh sạch enzyme bằng bằng (NH4)2SO4

Tiến hành tinh sạch enzyme bằng cách cho từ từ (NH 4)2SO4 bão hòa 30, 40, 50,

60 và 70% vào dịch nuôi cấy sau khi đã ly tâm khuấy cho tan hết. Sau đó để kết tủa

trong tủ 40C trong vòng 1 giờ rồi ly tâm lấy tủa ( 6000 v/p ở 40C trong 5 phút). Phần dịch

tủa được hòa tan bởi đêm photphate pH = 6,5. Dịch enzyme β- galactosiase tinh sạch

được dùng để xác định hoạt tính và hoạt tính riêng từ đó xác định độ tinh sạch của enzyme

và hiệu suất thu hồi của phương pháp (Nguyễn và cs, 2006).

Hoạt tính riêng của enzyme đặc trưng cho độ tinh sạch của chế phẩm enzyme.

Hoạt tính riêng được biểu thị bằng số đơn vị enzyme/mg protein (U/mg protein) trong

đó số đơn vị enzyme (hay hoạt tính enzyme U/ml) được xác định theo phương pháp

3.3.3, tổng hoạt tính được tính theo thể tích dịch enzyme cuối cùng thu được sau khi

tinh sạch bằng muối (NH4)2SO4. Hàm lượng protein được xác định theo phương pháp

Bradford, protein tổng số được tính theo thể tích dịch enzyme cuối cùng thu được sau

khi tinh sạch bằng muối NH4)2SO4.

3.3.7.Phương pháp định lượng protein tổng số bằng phương pháp Bradford

Phương pháp xác định protein tổng số theo Bradford, 1976 được mô tả như sau:

Nguyên tắc:

Phương pháp này dựa trên sự thay đổi bước sóng hấp thu cực đại của thuốc

nhuộm Coomassie Brilliant Blue khi tạo phức hợp với protein. Trong dung dịch mang

tính acid khi chưa kết nối với protein thì thuốc nhuộm ở dạng màu đỏ có bước sóng

hấp thu cực đại là 465 nm khi kết hợp với protein thì thuốc nhuộm chuyển sang dạng

màu xanh dương và hấp thu cực đại ở bước sóng 595nm.

Tiến hành:

Bước 1: Để xác định protein trong mẫu, đầu tiên ta xây dựng một đường chuẩn

với dung dịch protein chuẩn đã biết trước nồng độ. Dung dịch protein chuẩn được sử

19



dụng là bovine serum albumin (BSA). Sau khi cho dung dịch protein vào thuốc nhuộm

màu, màu sẽ xuất hiện trong 2 phút và bền tới 1 giờ.

Dựng đường chuẩn protein:

Bảng 3.8 Pha dãy đường chuẩn protein

Ống nghiệm

1

2

BSA ( 1mg/ml)(µl)

80

60

Nước cất (µl)

20

40

Nồng độ BSA (mg/ml)

0.8

0.6

Hút từ mỗi ống nghiệm 25µl dịch protein chuẩn



3

4

5

40

20

10

60

80

90

0.4

0.2

0.1

vào các ống nghiệm khác có



chứa sẵn 1000µl thuốc nhuộm Coomassie Brilliant Blue, lắc đều bằng máy lắc vontex,

để yên 20 phút trong bóng tối. Sau 20 phút, tiến hành đo dung dich bằng máy đo quang

phổ kế ở bước sóng 595nm ta được các giá trị OD, độ hấp thu sẽ tỷ lệ với lượng

protein trong mẫu.

Vẽ đường tuyến tính giữa nồng độ protein (mg/ml) với mật độ quang Abs 595 ta

được phương trình tuyến tính y= ax + b. Dựa vào đường tuyến tính y= ax + b ta tính

được lượng protein có trong mẫu thí nghiệm.

Kết quả : Đường chuẩn có phương trình y= 0.3161x + 0.0387, trong đó x giá trị

BSA (mg/ml), y là giá trị OD ở bước sóng 595 nm (hình 3.2).



Hình 3.2 Đường chuẩn protein

Bước 2: Mẫu thí nghiệm

Các mẫu thí nghiệm được làm tương tự, thay 25µl mẫu protein chuẩn bằng 25µl

mẫu thí nghiệm. Lượng protein trong mẫu được tính dựa vào phương trình đường

chuẩn protein:

20



x =

Trong đó:

x: là lượng protein trong mẫu (mg)

y: là OD595 đo được của mẫu.

3.3.8 Phương pháp xác định đặc tính của enzyme β- galactosidase

3.3.8.1 Xác định nhiệt độ tối ưu và độ bền nhiệt của enzyme β- galactosidase

Xác định nhiệt độ tối thích của enzyme β- galactosidase như trình bày ở 3.3.3.

ở các điều kiện nhiệt độ khác nhau (20, 30 0C, 370C, 400C, 500C, 550C, 600C, 650C,

700C, 750C, 800C). Các điều kiện thí nghiệm và thời gian thí nghiệm như phần 3.3.3.

chỉ khác nhau về nhiệt độ phản ứng.

Sau khi xác định được nhiệt độ tối ưu cho phản ứng thủy phân, chúng tôi tiến

hành xác định độ bền nhiệt của enzyme tại nhiệt độ tối ưu và 60 0C, tại các thời gian

khác nhau, enzyme được lấy ra để xác định hoạt tính. Hoạt tính của enzyme được xác

định như phần 3.3.3. Thời gian được kéo dài tới thời gian bán hủy của enzyme (thời

gian mà hoạt tính enzyme còn 50%).

3.3.8.2 Phương pháp xác định pH tối ưu và độ bền pH

Tiến hành thử nghiệm với các mức pH từ 3 đến 8 trong đệm Britton- Robinson

(40mM sodium citrate, 40mM sodium phosphate, 40mM borate, sử dụng NaOH 0,2M

để chỉnh pH về giá trị mong muốn). Hoạt tính enzyme được xác định dựa vào cách xác

định hoạt tính enzyme chuẩn như phần 3.3.3.

Độ bền pH được xác định tại các pH 3, 4, 5, 6, 7, 8 ở 37 0C. Tại các thời điểm

khác nhau, enzyme được lấy ra để xác định hoạt tính, hoạt tính của enzyme được xá

định như phần 3.3.3. Thời gian được kéo dài đến thờ gian bán hủy của enzyme (thời

gian mà hoạt tính enzyme còn 50%).

3.3.8.3. Phương pháp xác định sự ảnh hưởng của các cation kim loại đến hoạt

tính của enzyme β- galactosidase

Các cation kim loại được bổ sung vào cơ chất oNPG trong đệm phosphate với

nồng độ là 5-15 mM, sau đó phản ứng được tiến hành như với phản ứng enzyme chuẩn

trong phần 3.3.3 và xác định hoạt tính enzyme β-glalactosidase. Sự ảnh hưởng của các

cation kim loại đến hoạt tính enzyme β-glalactosidase được xác định bằng cách so



21



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

- Cách 3: Xác định khả năng sinh β-galactosidase bằng phương pháp cấy ria trên đĩa thạch

Tải bản đầy đủ ngay(0 tr)

×