Tải bản đầy đủ - 0 (trang)
Chương 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Chương 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ - 0trang

Cân phân tích AB 240, Máy chuẩn pH tự động



Thụy Sỹ



Máy li tâm lạnh Eppendof 524, Máy soi gel, Bể ổn nhiệt, Đức

Tủ ấm Binder, Máy PCR

Máy quang phổ UV-1800, Nồi khử trùng, Tủ lạnh



Nhật Bản



Máy điện di, Máy cất nước 1, 2 lần



Anh



Tủ cấy vô trùng Holten Safe



Đan Mạch



Máy ni cấy lắc ổn nhiệt



Mỹ



La enzyme, lam kính, dao lam, pipet, ống eppendof, ống Trung Quốc

sinh hàn, phễu chiết, đĩa petri

2.1.3. Địa điểm và thời gian nghiên cứu

Địa điểm nghiên cứu: Luận văn được thực hiện tại các phòng thí nghiệm Vi

sinh vật, Cơng nghệ gen, Thực vật học, Hóa sinh học thuộc Khoa Sinh học và

phòng Hóa hữu cơ thuộc Khoa Hóa học, Trường Đại học Sư Phạm Thái Nguyên.

Thời gian nghiên cứu: Từ tháng 3/2018 đến tháng 4/2019.

2.2. Phương pháp nghiên cứu

2.2.1. Phương pháp phân loại hình thái

- Trước khi xác định tên khoa học của loài A. lienii, tiến hành điều tra thực

địa thu thập mẫu tiêu bản của lồi này với đầy đủ các thơng tin liên quan bao gồm:

Mẫu tiêu bản, ảnh màu, phân bố của loài, sinh thái.

- Xác định tên khoa học của các lồi theo phương pháp hình thái so sánh sau:

+ Sử dụng các sách chuyên khảo phân loại thực vật về họ Chè (Theaceae) để

phân loại bao gồm: Phạm Hoàng Hộ (1999), Cây cỏ Việt Nam, tập 1; Tianlu

Min & Bruce Bartholomew (2015), Flora of China; Gagnepain (1908), Flore

Génera Indochina,…

2.2.2. Phương pháp giải phẫu thực vật

* Cấu tạo giải phẫu thân và lá của cây A. lienii được thực hiện theo hướng

dẫn của Hoàng Thị Sản và Nguyễn Phương Nga (2008) [22].

- Các mẫu rễ, thân và lá sau khi thu về được cắt thành những lát mỏng bằng

dao lam. Các lát cắt được ngâm vào nước cất trong đĩa petri. Sau đó tiến hành

nhuộm lát cắt bằng phương pháp nhuộm kép với các bước như sau:



22



Bước 1: Lát cắt được ngâm vào dung dịch javen trong thời gian từ 15-30

phút để tẩy sạch nội chất của tế bào.

Bước 2: Rửa sạch lát cắt đã được ngâm trong javen bằng nước cất.

Bước 3: Tẩy sạch hết javen còn dính lại trên lát cắt bằng cách ngâm vào dung

dịch axit axetic.

Bước 4: Rửa sạch mẫu bằng nước cất (2 lần).

Bước 5: Nhuộm mẫu bằng dung dịch carmine trong khoảng 25-30 phút.

Bước 6: Rửa mẫu trong nước cất.

Bước 7: Mẫu được nhuộm trong dung dịch xanh metylen loãng khoảng 20 giây.

Bước 8: Rửa sạch mẫu bằng nước cất.

Bước 9: Nhỏ 1 giọt nước lên lam kính, đặt mẫu vật và đậy laenzyme. Quan

sát lát cắt trên kính hiển vi ở vật kính có độ phóng đại 4-10 lần để thu kết quả.

- Phương pháp chụp ảnh: Ảnh được chụp trên kính hiển vi kết nối máy tính

sử dụng phần mềm Microscope manger tại Phòng thí nghiệm Thực vật học Khoa

Sinh học với các độ phóng đại khác nhau.

- Phương pháp mơ tả, so sánh hình thái cấu tạo giải phẫu theo các tài liệu

của: Nguyễn Bá (Hình thái thực vật (tập 1) và Giải phẫu hình thái thực vật (tập 2)

[3]; Thực tập hình thái và giải phẫu thực vật của Trần Công Khánh (1981) [16];

Giải phẫu thực vật: Katheri Esau(1995) [14]; Giải phẫu và hình thái thực vật của

Kixeleva (1998) [18].

* Các chỉ tiêu nghiên cứu

- Đặc điểm hình thái ngồi: Dạng sống, kiểu thân và đặc điểm của thân, lá

(hình dạng phiến lá, chóp lá, gân lá, gốc lá, cuống lá, kích thước…); hoa (dạng

cụm hoa, vị trí cụm hoa, kích thước, lá bắc, bộ nhị, bộ nhụy…); quả và hạt (hình

dạng, màu sắc, kích thước…).

- Đặc điểm cấu tạo thân: Gồm phần vỏ sơ cấp và phần trụ giữa, xác định số

lớp tế bào, kích thước, tỷ lệ các phần, số lượng mạch/mm 2, đo kích thước mạch,

xác định kiểu mạch. Những nhận xét về mối quan hệ giữa cấu tạo giải phẫu với

đặc điểm của môi trường sống.

- Đặc điểm cấu tạo giải phẫu của phiến lá: Cấu tạo biểu bì, số lượng lỡ khí,

kiểu lỡ khí, số lớp tế bào biểu bì. Đặc điểm mơ đồng hóa: xác định số lớp tế bào

mơ giậu, mơ xốp, kích thước giữa các phần, tỷ lệ mô giậu/mô xốp.

23



2.2.3. Phương pháp sinh học phân tử

Mẫu được lựa chọn là mẫu lá bánh tẻ khơng bị sâu bệnh nấm mốc, lấy

mẫu/lồi từ các cây độc lập. Sau khi thu, mẫu được bảo quản trong túi nilon có

chứa hạt silicagel hút ẩm, ghi đầy đủ thông tin mẫu và được giữ ở -80°C để tách

chiết DNA phục vụ nghiên cứu.

Phương pháp tách chiết DNA tổng số từ mẫu lá của loài A. lienii

(1) DNA tổng số được phân lập từ lá non dựa trên phương pháp của Shaghai

và đồng tác giả (1984) [37]. 0,8 g lá cây tươi mỗi giống được nghiền trong nitơ

lỏng sau đó bổ sung 6 ml đệm rửa (Tris-HCl 100 mM, pH 8,0; EDTA 5 mM, pH

8,0; NaH2PO4 0,4%; sorbitol 350 mM; H2O) lắc đều và ly tâm 12.000 vòng/phút

trong 15 phút ở 4°C, loại dịch để thu cặn (lặp lại thao tác này 1 lần).

(2) Bổ sung 700µl đệm chiết (Tris-HCl 100 mM, pH 8,0; EDTA 20 mM, pH

8,0; CTAB 4%; NaCl 1,4M; H20) vào mỗi ống, đảo đều và ủ 30-60 phút ở 65°C từ

5-10 phút đảo nhẹ ống 1 lần, để ở nhiệt độ phòng 5 phút và ly tâm 12.000

vòng/phút trong 15 phút ở 4°C, thu dịch sang ống mới.

(3) Bổ sung chloroform : isoamyl alcohol (24:1) với tỷ lệ 1:1 về thể tích so

với dịch mẫu; đảo nhẹ ống 2-3 lần và ly tâm 12.000 vòng/phút trong 15 phút ở

4°C, thu dịch pha trên sang ống mới.

(4) Bổ sung phenol : chloroform : isoamyl alcohol (25:24:1) với tỷ lệ 1:1 về

thể tích so với dịch mẫu; đảo nhẹ ống 2-3 lần và ly tâm 12.000 vòng/phút trong 15

phút ở 4°C, thu dịch pha trên sang ống mới.

(5) Tủa DNA với isopropanol tỷ lệ 1:1 về thể tích, giữ -20°C trong 2 giờ và

ly tâm 12.000 vòng/phút trong 15 phút ở 4°C thu tủa và rửa bằng 500µl ethanol

70%, sau đó ly tâm 12.000 vòng/phút trong 10 phút ở 4°C và thu tủa, để khơ ở

37°C. Sau đó, tủa được hòa trong 30 μl TE và 0,25 μl RNase và ủ 15 phút ở 37°C.

Nhân bản gen matK bằng phản ứng PCR: Gen matK được nhân bản với

cặp mồi đặc hiệu được thiết kế theo Kress và cộng sự (2005) (Bảng 2.3) bằng

phản ứng PCR có thành phần như trong bảng 2.4 và chương trình nhiệt bên dưới.



Vùng

gen



Tên

mồi



Bảng 2.3. Thơng tin về cặp mồi nhân gen matK

Trình tự mồi (5’  3’)

Nhiệt độ

gắn mồi



24



Sản

phẩm



dự kiến

matK



P9F

P9R



CGATCTATTCATTCAATATTTC

TCTAGCACACGAAAGTCGAAGT



550C



~800pb



Bảng 2.4. Thành phần phản ứng PCR nhân gen matK

Thành phần

Nồng độ

Thể tích (µl)

2x PCR Master mix solution



10,0



Mồi xi



10 pmol/μl



1,0



Mồi ngược



10 pmol/ μl



1,0



DNA khuôn



50-100 ng/l



1,0



H2O khử ion vô trùng



7,0



Tổng thể tích



20,0



Chương trình phản ứng PCR: 94°C trong 3 phút; (94°C: 30 giây, 55°C: 30

giây, 72°C: 1 phút) lặp lại 40 chu kỳ; 72°C trong 5 phút; sau đó bảo quản sản

phẩm PCR ở 4°C. Nhiệt độ gắn mồi các phản ứng khác nhau phụ thuộc vào cặp

mồi sử dụng. Mỗi phản ứng PCR lặp lại 3 lần trên mỗi mẫu thí nghiệm. Kết quả

PCR được kiểm tra bằng điện di trên gel agarose 1,0%, quan sát kết quả dưới đèn

cực tím (UV) và chụp ảnh. Sản phẩm PCR được tinh sạch theo hướng dẫn của kit

tinh sạch sản phẩm PCR của Norgen, Canada.

Sau khi tinh sạch sản phẩm PCR được gửi đi để giải trình tự. Trình tự

nucleotide của đoạn DNA được xác định tại bằng máy giải trình tự, sử dụng bộ Kit

BigDye® Terminator v3.1 Cycle Sequencing.

2.2.4. Phương pháp hóa sinh

2.2.4.1. Phương pháp điều chế mẫu thử hoạt tính

Lồi A. lienii sau khi thu hái về được thái nhỏ, phơi trong bóng mát, sấy khơ

ở nhiệt độ 50ºC đến khối lượng khơng đổi, sau đó đem nghiền nhỏ.



25



Hình 2.1. Sơ đồ chiết phân đoạn các hợp chất từ cây A. lienii

Mẫu nghiền được ngâm chiết 2 lần bằng ethanol trong thiết bị siêu âm ở

nhiệt độ phòng. Dịch tổng số được cất kiệt dung môi dưới áp suất giảm, nhiệt độ

<50ºC và thu được cặn cô ethanol. Cặn cô ethanol được chiết với các dung mơi có

độ phân cực tăng dần lần lượt là ethyl axetate và dichlomethane. Sau khi cất đuổi

dung môi thu được cặn dịch dichlomethane, ethyl axetate và cặn chiết. Các cặn

dịch thu được sẽ đưa đi sấy khô ở nhiệt độ 50ºC và thu được cao sấy khô tương

ứng. Các cao chiết được cho vào bình thủy tinh, có ghi nhãn, đậy kín và bảo quản

ở nhiệt độ thường để sử dụng trong các nghiên cứu tiếp theo. Quy trình điều chế

mẫu được trình bày tóm tắt ở hình 2.1.

2.2.4.2. Định tính polyphenol

a/ Phản ứng với muối sắt (III)

- Sử dụng thuốc thử là dung dịch muối sắt (III).

- Tiến hành: Lấy 5ml dịch thử (dịch chiết bằng ethanol) cho vào 2 ống

nghiệm ký hiệu lần lượt là A và B. Cho thêm 0,5ml muối sắt (III) vào ống B và



26



quan sát hiện tượng. Tùy theo số lượng và vị trí nhóm hydroxyl trong phân tử

polyphenol mà cho màu lục, xanh hoặc nâu.

b/ Phản ứng với H2SO4 đặc

- Sử dụng thuốc thử là dung dịch H2SO4 đặc.

- Tiến hành: Lấy 2ml dịch thử (dịch chiết bằng ethanol) vào 2 ống nghiệm ký

hiệu lần lượt là A và B. Cho thêm 1-2 giọt H 2SO4 đặc vào ống B và quan sát hiện

tượng. Khi nhỏ H2SO4 đặc lên các dẫn xuất của flavon và flavonol thì cho màu

vàng đậm; đối với chalcon và auron cho màu đỏ, đỏ thắm và đỏ tươi; flavanon cho

màu đỏ da cam do sự chuyển thành chalcon.

2.2.4.3. Định tính các flavonoid

- Sử dụng thuốc thử là dung dịch axit HCl đặc và bột Mg kim loại.

- Tiến hành: Lấy 0,05g cặn chiết ethanol vào ống nghiệm và thêm 10 ml

CH3OH lắc đều, đun nóng ống nghiệm cho tan và lọc qua giấy lọc. Lấy 2 ml dịch

đã lọc vào 2 ống nghiệm ký hiệu lần lượt là A và B. Thêm một ít bột Mg kim loại

vào cả 2 ống, lắc đều và cho 5 giọt HCl đặc vào ống B, đun trong bình cách thuỷ

vài phút và quan sát thấy dung dịch có màu từ vàng, đỏ đến xanh là dương tính với

các flavonoid.

2.2.4.4. Định tính các coumarin

- Sử dụng thuốc thử là dung dịch NaOH 10%.

- Tiến hành: Lấy 2ml dịch thử (dịch chiết bằng ethanol) vào 2 ống nghiệm ký

hiệu lần lượt là A và B. Cho vào ống B 0,5 ml dung dịch NaOH 10%. Đun cả 2 ống

trên bếp cách thủy đến sôi, lấy ra để nguội cho thêm 4 ml nước cất vào cả 2 ống A và

B. Quan sát thấy chất lỏng ở ống B (có kiềm) trở lên trong suốt hoặc trong hơn ống

A (khơng kiềm) có thể xem là có coumarin. Nếu đem axit hố ống nghiệm có kiềm

bằng một vài giọt HCl đặc mà làm cho dịch mất màu vàng đục hoặc xuất hiện kết tủa

bơng (cũng có khi xuất hiện kết tủa) thì có thể kết luận có coumarin [15].

2.2.4.5. Phương pháp sắc kí lớp mỏng (TLC)

Sắc ký lớp mỏng hay còn gọi là sắc ký phẳng là kỹ thuật phân bố rắn - lỏng.

Trong đó, chất lỏng được đi xuyên qua một lớp chất hấp thụ trơ như silicagel hoặc

nhôm oxit, chất hấp thụ này được tráng thành một lớp mỏng, đều phủ lên một nền

phẳng như tấm kính, tấm nhôm, hoặc tấm plastic được gọi là pha động.



27



Sử dụng bản mỏng TLC silicagel 60 F254 của hãng Merck được cắt bằng kéo

thành bản hình chữ nhật có kích thước 3,5 cm x 1,0 cm. Sử dụng ống mao quản

để đưa mẫu lên bản mỏng dưới dạng vạch. Ðường xuất phát cách mép dưới của

bản mỏng 0,7 cm. Bình khai triển là bình thủy tinh hình trụ cao 9 cm, đường kính

miệng 5 cm, có nắp đậy kín. Rót một lượng vừa đủ dung mơi vào bình. Lượng

dung mơi dày khoảng 3-5 mm ở đáy bình. Ðặt bản mỏng gần như thẳng đứng với

bình triển khai, các vết chấm phải ở trên bề mặt của lớp dung môi khai triển. Ðậy

kín bình và để n ở nhiệt độ khơng đổi. Khi dung môi đã triển khai trên bản

mỏng được một đoạn, lấy bản mỏng ra khỏi bình, đánh dấu mức dung mơi, làm

bay hơi dung mơi còn đọng lại trên bản mỏng. Hiện màu bằng dung dịch H 2SO4

10% rồi sấy khô trên bếp điện đến khi hiện màu [6].

Hệ dung mơi triển khai sắc kí được sử dụng: n-hexan : acetone tỉ lệ 1:1;

Dichlomethane : n-hexan tỉ lệ 3:1.

2.2.5. Phương pháp thử hoạt tính kháng khuẩn của cao chiết

Xác định hoạt tính kháng khuẩn của cao chiết bằng phương pháp đục lỗ

thạch của Bauer và cộng sự [23], [25].

(1) Chuẩn bị các đĩa petri chứa môi trường LB đặc. (2) Hút 70µl dịch ni

mỡi lồi vi khuẩn trong mơi trường LB lỏng đã được hoạt hóa bằng ni từ 4-8

giờ trong môi trường LB lỏng ở 28℃, lắc 200 vòng/phút, lên đĩa mơi trường LB

đặc và trải đều trên mặt thạch cho đến khi khô. (3) Dùng khoan nút chai vơ trùng

có đường kính 1cm đục 4 giếng trên đĩa thạch và nhỏ 100 µl cao chiết mỡi loại từ

cây A. lienii vào 3 giếng ở các nồng độ 2,0g; 6,0g và 20 g/100ml (giếng đối chứng

bổ sung DMSO). (4) Đặt các đĩa petri đã bổ sung dịch vào tủ lạnh 4°C khoảng

1-2h cho dịch chiết khuếch tán đều vào môi trường và đặt vào tủ ấm nuôi ở 30°C,

từ 18-24h. (5) Đo đường kính vòng kháng khuẩn, chụp hình và ghi lại kết quả.

Mỡi thí nghiệm lặp lại 3 lần.

Đường kính vòng kháng khuẩn được xác định theo cơng thức: H = D-d (mm)

Trong đó: D là đường kính vòng vơ khuẩn tính từ tâm đục lỡ (mm); d là

đường kính đục lỡ thạch (mm)

Quy ước: (D - d) ≥ 25 mm: Có hoạt tính kháng khuẩn rất mạnh.

(D - d) ≥ 20 mm: Có hoạt tính kháng khuẩn mạnh.

(D - d) ≥ 15 mm: Có hoạt tính kháng khuẩn trung bình



28



(D - d) ≤ 15 mm: Có hoạt tính kháng khuẩn yếu.

2.2.6. Phương pháp xử lý và phân tích kết quả

Sử dụng phần mềm Microsoft Excel để thống kê số liệu và phần mềm

DNAStar, BioEdit và BLAST trong NCBI để phân tích hệ gen.



29



Chương 3. KẾT QUẢ NGHIÊN CỨU

3.1. Đặc điểm hình thái ngồi và phân bố của loài Adinandra lienii

Loài Adinandra lienii là cây thân gỡ, thường xanh, cao khoảng 8-10 m. Thân

màu nâu, có lông bao phủ. Cuống lá dài khoảng 0,5-0,7 cm, thô ráp. Lá đơn, mọc

cách. Phiến lá bản to, hình thn dài, dài khoảng 25-30 cm và rộng 8-12cm. Lá có

màu xanh lục khi tươi, màu nâu khi khô, mặt trên nhẵn, mặt dưới có lơng bao phủ.

Gốc lá tròn hoặc nhọn, chóp lá có mũi nhọn, dài khoảng 1,2-1,4 cm. Gân lá hình

lơng chim, gân bên rõ, có khoảng 20-25 cặp, gân giữa mặt trên có rãnh nơng, mặt

dưới hơi lồi. Hoa mọc ở nách lá, cuống hoa dài 1-2 cm. Nụ hoa hình cầu, đường

kính khoảng 1,5 cm. Cây thường ra hoa vào mùa hè, thời gian từ tháng 5 đến

tháng 8 hàng năm. Cây mọc sâu trong rừng núi cao và phân bố ở tỉnh Hà Giang,

Lào Cai Việt Nam (Hình 3.1).



Hình 3.1. Hình thái ngồi của cây A.lienii (Ảnh chụp của tác giả thu tại Lào Cai,

tháng 3, năm 2018)

30



3.2. Cấu tạo giải phẫu của loài Adinandra lienii

3.2.1. Đặc điểm giải phẫu cắt ngang thân cây

Cấu tạo giải phẫu của thân đối xứng toả tròn và có sự chuyển hóa rất cao của

các mơ. Trên lát cắt ngang thân non của lồi A. lienii, có thể phân biệt 9 lớp cơ bản

từ ngoài vào trong, gồm: biểu bì, mơ dày xốp, mơ mềm vỏ, mơ cứng, libe, gỡ, mơ

mềm ruột và lơng che chở (Hình 3.2).

Lớp biểu bì (1): Phủ ngồi thân là một lớp tế bào dày gồm những tế bào hình

trứng xếp xít nhau uốn lượn theo thân tạo thành vòng ngồi cùng, bắt màu xanh,

dày khoảng 10 µm, biểu bì đã hóa bần; có vai trò bảo vệ và che chở cho những

tầng trong của cây.

Mô dày xốp (2): Gồm 3-4 lớp tế bào xếp sít nhau, ít có khoảng gian bào, tế

bào hình tròn hoặc hình trứng. Trong tế bào mơ dày gồm những tế bào sống, vách

dày bắt màu hồng, có chức năng nâng đỡ; có màng sơ cấp dày, khơng hóa gỗ, vẫn là

màng bằng xenluloz; mô dày xốp được coi là mơ mềm có màng dày, chun hóa

với chức năng cơ học.

Mô mềm vỏ (3): Gồm 6-8 lớp tế bào hình trứng, khơng có diệp lục, to hơn

các tế bào mô dày, xếp thưa để lại nhiều khoảng gian bào, có các bào quan, thể

vùi; chức năng chính là dự trữ và dinh dưỡng.

Mô cứng (4): Là mô nâng đỡ những cơ quan đã trưởng thành không sinh

trưởng tiếp nữa. Mơ cứng gồm những tế bào thứ cấp có màng dày hóa gỡ, các tế

bào rất khác nhau về hình dạng, cấu tạo và tính chất. Khi trưởng thành, nội chất

tiêu biến, gồm những tế bào chết. Các tế bào tập trung thành từng đám mô cứng

xếp gần như liên tục tạo thành một vòng, đảm nhiệm chức năng cơ học. Kích

thước của đám mơ cứng khơng đều dày từ 22-50 µm.

Libe (5): Gồm những tế bào hình đa giác, xếp sít nhau, bắt màu hồng, có

màng mỏng; các tế bào libe phân hóa hướng tâm.

Tầng phát sinh (6): Gồm các tế bào sống, có hình chữ nhật hơi dài. Các tế

bào của tầng sinh trụ phân chia theo hướng tiếp tuyến trong cho gỗ thứ cấp và

phân chia theo hướng tiếp tuyến ngồi cho libe thứ cấp.

Gỡ (7): Gồm 5-6 lớp tế bào chết, bắt màu xanh, xếp thành vòng tròn liên tục.

Hệ dẫn của thân gồm gỡ và libe phát triển thành vòng liên tục, phần gỡ phát triển

với nhiều mạch gỡ và mơ mềm gỡ, mạch có hình đa giác xen lẫn với các tế bào mơ

31



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Chương 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ ngay(0 tr)

×