Tải bản đầy đủ - 0 (trang)
CHƯƠNG 2: ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN

CHƯƠNG 2: ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN

Tải bản đầy đủ - 0trang

- Nghiên cứu các đặc tính sinh lý, sinh hóa của chủng vi khuẩn được tuyển chọn.

- Định danh chủng vi khuẩn tuyển chọn bằng kĩ thuật sinh học phân tử.

2.5.



Phương pháp nghiên cứu.



2.5.1. Sơ đồ bố trí thí nghiệm

Sơ đồ bố trí thí nghiệm thể hiện ở hình 2.1.



Hình 2.1. Sơ đồ bố trí thí nghiệm



11



2.5.2. Phương pháp thu mẫu

Lấy các mẫu rễ cây lạc phải tốt, rễ phải có nốt sần to, nhiều kẻ sọc trắng, màu

hồng ở thời kì cây đang ra hoa và phải đảm bảo các mẫu không bị biến đổi trong thời

gian từ khi lấy mẫu tới khi phân tích.

Tiến hành: dùng kéo, dao mổ vô trùng cắt khoảng 2g mẫu cho vào túi ziplock vơ

trùng, đậy kín, đánh số, ghi địa điểm lấy mẫu, ngày tháng, bảo quản trong thùng nước

đá và được vận chuyển về phòng thí nghiệm, giữ ở 4 oC. Các mẫu được phân lập ngay

không quá 24h [7], [14].

2.5.3. Phương pháp phân lập

Cách tiến hành:

- Cân 1-2g mẫu rễ. Nốt sần có nhiều tạp khuẩn, phải tiệt trùng trước khi phân lập.

Rửa sạch nốt sần, lấy kéo cắt nốt sần ra khỏi rễ. Chú ý không làm nốt sần xây xát. Cho

nốt sần vào nước trong rửa sạch, cho cồn 95º vào trong 3 phút rửa sạch, cho tiếp vào

dung dịch HgCl2 0.1% trong 5 phút, rửa bằng nước vơ trùng 5 đến 6 lần. Sau đó dùng

cối nghiền nát nốt sần, cho vào cốc thêm 2ml nước cất [3], [20].

- Dùng pipet vô trùng hút 1ml dung dịch trên cho vào ống nghiệm chứa sẵn 9ml

nước cất vô trùng, lắc đều ta được độ pha loãng 10 -1. Tiếp tục pha loãng như vậy đến

độ pH loãng 10-4, 10-5. Dùng pipet vô trùng hút ở mỗi độ pha lỗng 100µl dịch mẫu và

nhỏ vào đĩa petri có chứa môi trường YMA đã được hấp khử trùng ở

121oC trong vòng 15 phút. Sau đó dùng que trang trải đều giọt dung dịch khắp mặt

thạch. Mỗi nồng độ pha loãng cấy trên 3 đĩa petri, bao gói cẩn thận và nuôi cấy trong

tủ ấm ở nhiệt độ 28 - 30oC trong 3 -7 ngày để tạo thành các khuẩn lạc riêng lẽ [16] .

- Làm thuần giống: Cấy ria các khuẩn lạc được lựa chọn lên các đĩa petri chứa

môi trường đặc để thu khuẩn lạc đơn. Quá trình làm thuần được tiến hành 2 đến 3 lần.

Chọn khuẩn lạc đơn đã được làm thuần cấy chuyền vào ống thạch nghiêng để giữ

giống [7], [16].

2.5.4. Phương pháp nghiên cứu đặc điểm hình thái tế bào và các test hóa sinh của

các chủng vi khuẩn được tuyển chọn

a. Phương pháp nghiên cứu đặc điểm hình thái tế bào

12



 Nhuộm Gram

Nguyên tắc: Do sự khác biệt về cấu trúc vách tế bào nên trong quá trình nhuộm

Gram, vi khuẩn Gram (+) sẽ giữ được phức hợp tím khơng bị tẩy màu bởi alcohol

trong khi Gram (-) không giữ được phức hợp màu này. Do vậy, sau khi nhuộm, vi

khuẩn Gram (+) vẫn giữ được màu tím còn vi khuẩn Gram (-) bắt màu hồng của

fuchsin [4], [7], [11].

Cách tiến hành:

Làm tiêu bản vệt bôi mẫu cần nhuộm.

-



Cố định mẫu bằng ngọn lửa đèn cồn.



-



Nhuộm tím gentian trong 1 phút, rửa nước (tối đa 5 giây), thấm khô.



-



Thêm dung dịch lugol trong 1 phút.



-



Rửa bằng cồn 90 độ trong 15-30 giây, rửa lại bằng nước, thấm khô.



-



Nhuộm bổ sung bằng fuchsin trong 1 phút, rửa qua nước, thấm khô rồi mang đi



quan sát dưới kính hiển vi quang học ở vật kính dầu 100X. Ghi nhận khả năng bắt màu

thuốc nhuộm, mô tả hình dạng tế bào.

b. Phương pháp kiểm tra các test sinh hóa

 Thử nghiệm khả năng di động

Nguyên tắc : Khả năng di động của vi khuẩn được ghi nhận khi thử nghiệm cấy

vi khuẩn trong thạch mềm. Nếu vi khuẩn chỉ phát triển xung quanh đường cấy thì vi

khuẩn khơng có tính di động, nếu vi khuẩn mọc lan rộng khỏi đường cấy thì vi khuẩn

có khả năng di động [1].

Cách tiến hành:

- Dùng que cấy có đầu nhọn cấy vi khuẩn theo kiểu chích sâu vào mơi trường

thạch mềm YMA.

- Đặt ống nghiệm thẳng đứng, ủ ở 30oC, quan sát sau 3 ngày.

 Thử nghiệm catalase

Nguyên tắc: Dựa vào khả năng sinh catalase và phân giải H 2O2 của các chủng

vi sinh vật.



13



Cách tiến hành: Dùng que cấy lấy một ít khuẩn lạc vi khuẩn phết lên giữa lam

kính sạch. Nhỏ vài giọt H2O2 3% phủ lên vi khuẩn. Đọc kết quả sau khoảng 15 giây.

Phản ứng catalase dương tính: có hiện tượng sủi bọt khí [4], [7].

c. Thử nghiệm khả năng chịu mặn

Để quan sát tính tăng trưởng của 2 chủng vi khuẩn cố định đạm chúng tôi cũng

quan sát khả năng tăng trưởng trên môi trường YMA có bổ sung muối NaCl 14%.

Nguyên tắc: Màu của mơi trường có chứa 2 chủng VK càng đục thì chứng tỏ

VK phát triển mạnh hơn so với các ống nghiệm chứa môi trường và VK trong hơn.

Cách tiến hành: Nuôi 2 chủng VK trong ống nghiệm chứa môi trường YMA

có bổ sung muối NaCl lần lượt là 1%, 2%, 3%, 4% và 1 ống nghiệm đối chứng chỉ

chứa môi trường YMA. Nuôi VK trong môi trường lỏng tĩnh nhiệt độ 28-300C, sau 3-5

ngày quan sát sự thay đổi [18].

d. Phương pháp xác định khả năng cố định nitơ của các chủng vi khuẩn tuyển chọn [5],

[13].

Dựa vào sự có mặt của sản phẩm đầu tiên của quá trình cố định đạm là amoni

(NH4+) trong MT nuôi cấy vô đạm để xác định khả năng cố định nitơ của các chủng

VK tuyển chọn.

Ngun tắc:

NH4+ có mặt trong dung dịch ni cấy sẽ tạo thành hợp chất màu vàng khi tác

dụng với thuốc thử Nessler. Theo phương trình phản ứng:

NH4+ + 2K2HgI4 + 4KOH = NH2HgOI + 7KI + 3H2O ( vàng nâu)

Cường độ màu của dung dịch thuốc thử phụ thuộc vào nồng độ của NH4 + trong

dung dịch.

Thuốc thử Nessler:

-



Dung dịch KI: cân 35g KI hòa tan trong 100ml nước cất.



-



HgCl2: cân 17g hòa tan vào 300ml nước cất.



-



Dung dịch NaOH: 20%

Sau đó đổ dung dịch HgCl2 vào dung dịch KI cho đến khi có kết tủa màu đỏ của



HgI2 tạo thành, khơng tan nữa thì ngừng lại. Dùng dung dịch kiềm 20% dẫn đến thể

14



tích 1 lít. Thêm 5ml dung dịch HgCl2 đến khi xuất hiện kết tủa đỏ. Để dung dịch lắng

đến khi hoàn toàn trong suốt, lọc lấy nước trong, bảo quản trong lọ mẫu. Hóa chất

khác: Dung dịch muối Xe-nhiet (C4H4O6KNa) 50%.

Cách tiến hành

Bước 1: Xây dựng đường chuẩn

Dung dịch amoniac tiêu chuẩn: cân chính xác 0,297g NH4Cl tinh khiết cho vào

cốc thủy tinh và hòa tan trong một ít nước cất, sau đó định mức thành 1000ml, lắc đều.

Ta được dung dịch chuẩn amoni (dd A), 1ml dung dịch này có 0,1mg NH4+.

Tiến hành pha lỗng 10 lần dung dịch trên để có dung dịch nồng độ 0,01mg NH4 +

trong 1ml bằng cách lấy 10ml dd A cho vào bình định mức 100ml và định mức bằng

nước cất cho đến vạch (dd B).

Sử dụng 5 bình định mức, lần lượt cho vào các bình định mức dung dich NH 4+

theo thứ tự bảng 2.1:

Bảng 2.1 : Chuẩn bị dung dịch mẫu chuẩn



Số bình định mức 100ml



1



2



3



4



5



(dd B) (ml)



0



5



10



15



20



Hàm lượng NH4+ (mg/l)



0



0,5



1



1,5



2



Dung dịch chuẩn NH4+



Kết quả so màu được trình bày trong bảng 2.2:

Bảng 2.2: Kết quả xác định đường chuẩn NH4+

Hàm lượng

NH4+ (mg/l)



0



0,5

15



1



1,5



2



OD



0



0,154



0,21



0,271



0,328



Từ kết quả trên ta có phương trình đường chuẩn: y = 0,1166x + 0,095 (R =

0,9997). Dựa vào phương trình đường chuẩn xác định được hàm lượng NH 4+ trong

mẫu nghiên cứu, trong đó y = OD và x = NH4+ mg/l trong mẫu.

Bước 2: Xác định hàm lượng NH4+ trong dịch ni cấy

Ly tâm 500 vòng/phút dịch ni cấy của các chủng VK nghiên cứu. Lấy 5ml

dịch trong cho vào ống nghiệm, sau đó thêm 0,5ml Xe-nhiet (C4H4O6KNa), tiếp theo là

1ml thuốc thử Nessler. So màu ở bước sóng 420nm và dựa vào đường chuẩn để xác

định hàm lượng NH4+ trong dịch nuôi cấy.

2.5.1.



Phương pháp định danh các chủng VK bằng kỹ thuật sinh học phân tử

Phương pháp định danh các chủng VK bằng kỹ thuật sinh học phân tử bao gồm



các bước sau đây:

a. Nuôi cấy sinh khối VK được chọn lọc

Các chủng VK Rhizobium sp. được chọn lọc nuôi trong 10 ml dung dịch LB

lỏng, lắc trên máy lắc trong 24 giờ ở nhiệt độ phòng để thu sinh khối [3].

b. Tách chiết và tinh sạch DNA tổng số

Sinh khối chủng Rhizobium sp. được sử dụng để tách chiết DNA tổng số theo

phương pháp của Gawel và cộng sự (1991) có sự cải tiến, sử dụng đệm chiết CTAB

[21].

Nguyên tắc của phương pháp tách chiết DNA tổng số (3 giai đoạn chính):

- Giai đoạn 1: Phá vỡ tế bào bằng phương pháp vật lý và hóa học. Tùy thuộc

vào từng loại tế bào, có cấu tạo thành và màng tế bào khác nhau, chọn phương pháp áp

dụng thích hợp, riêng rẽ hay phối hợp. Đối với Rhizobium sp. sử dụng đệm chiết

CTAB và dùng cát thủy tinh để phá vỡ tế bào VK .

- Giai đoạn 2: Loại bỏ các thành phần không mong muốn trong mẫu (protein,

lipid, polysaccharide…) chủ yếu là protein. Mẫu được ly tâm mạnh trong dung dịch

C:I (chloroform: isoamyl acohol - 24:1). Dung dịch này có tác dụng làm biến tính

protein, đồng thời khơng hòa tan acid nucleotic vì thế sau khi ly tâm protein sẽ tủa

thành một lớp giữa dung dịch có chứa acid nucleotic và C:I. Thu nhận lớp ở trên có

chứa acid nucleotic.

- Giai đoạn 3: Kết tủa acid nucleotide bằng isopropanol, thu nhận acid

16



nucleotide dưới dạng cô đặc, nhằm bảo vệ chúng khỏi sự phân hủy của các enzyme,

mặt khác để hòa tan chúng lại trong dung dịch theo nồng độ mong muốn. Sau đó hòa

tan trong ethanol 70% để loại bỏ dấu vết của isopropanol còn dính trên mẫu.

Quy trình tách chiết DNA tổng số:

- Lấy 1.5ml dịch ni cấy tế bào đem ly tâm 6000 vòng/phút trong vòng 10

phút, loại bỏ dịch thu cặn tế bào.

- Tái sinh huyền phù sinh khối bằng 500 µL đệm chiết CTAB (ủ ở 60oC

khoảng 10 phút trước khi sử dụng, votex, để mẫu trên đá lạnh).

- Bổ sung 100 mg glass bead, votex mạnh trong 1 phút.

- Bổ sung 500 µL CI (chloroform/ isoamyl alcohol (24:1), votex. Ly tâm

13.000 vòng/phút, 5 phút. Chuyển 400 µL dịch trong sang tube effendorte mới.

- Bổ sung thể tích tương đương isopropanol, trộn nhẹ. (ủ nhiệt độ -20 oC trong

vòng 30 phút để tủa DNA và bảo vệ chúng khỏi sự phân hủy của các enzyme). Ly tâm

13.000 vòng/phút, 10 phút, thu kết tủa.

- Rửa tủa bằng cách cho 500 µL ethanol 70%, sau đó ly tâm 13.000 vòng/phút,

5 phút, đổ bỏ dịch, để khơ tự nhiên.

b.



- Kết tủa được hòa lỗng trong 20 µL nước cất vô trùng, bảo quản ở -20oC.

Khuếch đại vùng gen 16S - rRNA

Gen mã hóa 16S - rRNA của chủng VK được khuếch đại bằng phản ứng PCR



từ DNA tổng số sử dụng cặp mồi:

Trình tự mồi để khuếch đại gen 16S – rRNA (bảng 2.3) [25].



Bảng 2.3 Trình tự cặp mồi được sử dụng để khuếch đại vùng gen 16S rRNA



Mồi

27F

1492R



Trình tự

5’- AGAGTTTGATCCTGGCTCAG – 3’

5’ – TACCTTGTTACGACTT – 3’



Hỗn hợp phản ứng khuếch đại có tổng thể tích là 20µL bao gồm:

Primer F: 1 µL (nồng độ 10pmol/ µL).

Primer R: 1 µL (nồng độ 10pmol/ µL).

PCR Master mix 2X: 10 µL (cơng ty TNHH MTV Sinh hóa Phù Sa).

DNA tổng số: 40 ng.

Nước cất 2 lần: được thêm đến thể tích 20 µL.

17



-



Khuếch đại vùng gen 1 được thực hiện trong máy luân nhiệt (AERiS –



BG096.EscoMicro Pte Ltd) theo chu trình ở hình 2.2.



Hình 2.2 Chu trình nhiệt của phản ứng khuếch đại PCR

Sản phẩm PCR được điện di trên gel agarose 1%, điện áp 90V, 120mA, trong

45 phút (sử dụng maker phân tử có kích thước khoảng 1Kb của công ty TNHH MTV

Phù Sa) và nhuộm bằng EtBr 0.05%. Hình ảnh điện di được quan sát dưới ánh sáng tử

ngoại (UV transilluminator, Wealtec).

c.



Đọc trình tự đoạn gen 16S – rRNA và định danh loài Rhizobium sp.

Sản phẩm PCR được gửi đến “Cơng ty TNHH MTV Sinh Hóa Phù Sa” để đọc



trình tự đoạn gen 16S – rRNA.

Kết quả đọc trình tự 16S – rRNA được so sánh trên ngân hàng gen NCBI để định

danh loài vi khuẩn.



18



CHƯƠNG 3: KẾT QUẢ VÀ BIỆN LUẬN

3.1.



Phân lập vi khuẩn Rhizobium sp.



Từ các mẫu rễ cây lạc ở khu vực xã Quế Châu, huyện Quế Sơn,

Tỉnh Quảng Nam nhóm nghiên cứu đã phân lập được một

chủng VK (kí hiệu L1) có khả năng sống sót trên mơi trường

YMA (có chứa cơng gơ đỏ) và khơng bắt màu cơng gơ đỏ. Sau

đó, nhóm tiến hành cấy sang mơi trường khơng có cơng gô đỏ

để làm thuần và quan sát màu sắc khuẩn lạc. Hình ảnh chủng

VK

được mơ tả ở hình 3.1

Hình 3.1 Hình của chủng VK

phân lập được từ rễ cây họ đậu

Nhóm nghiên cứu tiếp tục tiến hành quan sát hình thái khuẩn lạc của chủng VK phân

lập thì nhận thấy chủng VK L1 có khuẩn lạc tròn, lồi, bóng, nhày, màu trắng đục, có

viền trong suốt và đường kính khoảng từ 2 2,2mm (hình 3.2).



19



Hình 3.2 Hình thái khuẩn lạc của chủng VK L1

Vì sử dụng mơi trường phân lập đặc trưng nên nhóm nghiên cứu nhận định

chủng VK phân lập được có xác suất cao là thuộc chi Rhizobium. Nhằm khẳng định

điều này, chúng tên tiến hành định danh đến tên chi của chủng VK được chọn lọc, sử

dụng phối hợp các phương pháp nhuộm Gram, quan sát hình thái tế bào dưới kính

hiển vi, kiểm tra khả năng di động, test catalase, khả năng chịu mặn và khả năng cố

định nitơ.

3.2. Kết quả nghiên cứu các đặc điểm hình thái tế bào, sinh hóa của các chủng vi

khuẩn được tuyển chọn

3.2.1. Kết quả quan sát hình thái tế bào dưới kính hiển vi

Khi quan sát dưới kính hiển vi ở vật kính 100X cho thấy chủng này bắt màu

hồng khi nhuộm Gram. Điều này chứng tỏ chủng VK L1này thuộc nhóm Gram âm

(hình 3.3). VK Gram âm ngồi lớp màng bao bọc tế bào chất ra còn có thêm một lớp

màng ngoài khác được cấu tạo bởi phospholipid và lipopolysaccharide. Màng ngồi có

chức năng như một cái lọc để chặn lại những phân tử có kích thước lớn từ 600 đến

1000 Da. Màng ngồi còn có tính chọn lọc rất cao đối với các các hợp chất kỵ nước do

trên màng có các phân tử các lipophilic [8].

Quan sát hình thái tế bào dưới kính hiển vi cho thấy chủng L1 thuộc Gram âm có

hình que ngắn, nằm riêng rẽ nhau, khơng sinh bào tử (hình 3.3). Căn cứ vào những mô

tả về chi VK Rhizobium xác suất cao là chủng vi khuẩn L1[6].

20



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

CHƯƠNG 2: ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN

Tải bản đầy đủ ngay(0 tr)

×