Tải bản đầy đủ - 0 (trang)
3 Phương pháp nghiên cứu

3 Phương pháp nghiên cứu

Tải bản đầy đủ - 0trang

25



- Tất cả các mẫu đều được xét nghiệm DNA-B19.

Xét nghiệm hóa sinh ,cơng thức máu : Xác định chỉ số WBC, HgB, CRP,

Anti CCP, RF và chụp X-Quang xương khớp ở tất cả bệnh nhân VKDT.

2.3.4 Kỹ thuật Nested – PCR phát hiện parvovirus DNA-B19

Xét nghiệm DNA-B19 bằng phương pháp Nested PCR

Xét nghiệm hóa sinh máu, hóa sinh miễn dịch, công thức máu : Định

lượng WBC, HgB, CRP, ESR, Anti CCP, RF, tốc độ máu lắng (ESR),

Kháng thể IgM và IgG đối với kháng nguyên B19V được phát hiện kỹ thuật

ELISA trong huyết tương bằng các mồi đặc hiệu theo quy chuẩn, trình tự của

mồi B19V được mơ tả bởi Durigon et al. (1993)[37]. Các trình tự của mồi là:

F-out ATACACTGTGGTTTTATGGGCCG,

R-out CCATTGCTGGTTATAACCACAGGT;

F-in GAAAACTTTCCATTTAATGATGTAG,

R-in CTAAAATGGCTTTTGCAGCTTCTAC. PCR được thực hiện bằng

cách sử dụng Maxima Hot Start Polymerase (Thermo Scientific) theo khuyến

cáo của nhà sản xuất Định lượng các yếu tố DNA B19V trong máu toàn phần,

trong huyết thanh, kháng thể đặc hiệu B19V IgG.

Các mẫu máu được thu thập và xử lý chống đông bằng K2EDTA thực hiện

xét nghiệm ngay trong vòng 4 giờ sau khi thu thập. Các mẫu máu toàn phần

tại 0,5 ml và các mẫu huyết tương ở khoảng 0,2 ml được đông lạnh và bảo

quản ở -80 ° C cho đến khi được sử dụng để phân tích.

Mức độ hoạt động của bệnh DAS 28; Thời gian mắc bệnh

Định lượng các yếu tố miễn dịch IgM, IgG



26



2.3.5 Phương pháp xử lý số liệu nghiên cứu

- Những số liệu được xử lý theo phương pháp thống kê y sinh học, trên

phần mềm SPSS. Các phương pháp toán và cơng thức sử dụng để so sánh hai

số trung bình, so sánh các tỷ lệ. Giá trị của các chỉ số trình bày Mean ±SD .

- Xác định sự khác biệt dựa vào độ tin cậy p:

• Chưa có ý nghĩa thống kê: Khi p > 0,05 (độ tin cậy < 95%)

• Có ý nghĩa thống kê:

p < 0,05: Độ tin cậy > 95,0%

p < 0,01: Độ tin cậy > 99,0%

p < 0,001: Độ tin cậy > 99,9 %

Kết quả được coi là có ý nghĩa thống kê với p < 0,05.



27



Chương 3

KẾT QUẢ



3.1 Đặc điểm chung của đối tượng nghiên cứu

Đặc điểm đối tượng nghiên cứu theo tuổi

Đặc điểm chung của đối tượng nghiên cứu theo giới

Phân tích một số đặc điểm lâm sàng, cận lâm sàng ở bệnh nhân VKDT

có DNA-B19

3.2 Tình trạng nhiễm P B19 ở bệnh nhân viêm khớp dạng thấp và nhóm chứng

- Phân tích một số đặc điểm lâm sàng

- Phân tích mốt số đặc điểm cận lâm ssàng

- Giải trình tự gen và xác định Parvovirus B19

3.3 Phân tích tình trạng đáp ứng miễn dịch chỗng virus PB19 ở bệnh

nhân VKDT



KIẾN NGHỊ

BÀN LUẬN



28



TÀI LIỆU THAM KHẢO

1.



Glant, T.T., K. Mikecz, and T.A. Rauch, Epigenetics in the

pathogenesis of rheumatoid arthritis. BMC Med. 2014 Feb 26;12:35.

doi: 10.1186/1741-7015-12-35.



2.



Lan, N.T.N., Viêm khớp dạng thấp. Nhà xuất bản y học, 2017. 6: p.

107-122.



3.



Blumel, J., et al., Parvovirus B19 - Revised. Transfus Med Hemother,

2010. 37(6): p. 339-350.



4.



Takahashi, Y., et al., Human parvovirus B19 in rheumatoid arthritis. Int

Rev Immunol, 1998. 17(5-6): p. 309-21.



5.



Kozireva, S.V., et al., Incidence and clinical significance of parvovirus

B19 infection in patients with rheumatoid arthritis. J Rheumatol, 2008.

35(7): p. 1265-70.



6.



Heegaard, E.D. and K.E. Brown, Human parvovirus B19. Clin

Microbiol Rev, 2002. 15(3): p. 485-505.



7.



Servant-Delmas, A. and F. Morinet, Update of the human parvovirus

B19 biology. Transfus Clin Biol, 2016. 23(1): p. 5-12.



8.



Sasaki and Takahashi, Human parvovirus B19 and rheumatoid

arthritis. Article in International Reviews of Immunology, 2007(200711-29).



9.



Hsu, T.C., et al., Increased expression and secretion of interleukin-6 in

human parvovirus B19 non-structural protein (NS1) transfected COS-7

epithelial cells. Clin Exp Immunol, 2006. 144(1): p. 152-7.



10.



Matsunaga, Y., et al., Low prevalence of antibody to human parvovirus

B19 in Singapore. Epidemiol Infect, 1994. 113(3): p. 537-40.



11.



Watanabe, T. and H. Kawashima, Acute encephalitis and

encephalopathy associated with human parvovirus B19 infection in

children. World J Clin Pediatr, 2015. 4(4): p. 126-34.



12.



Ivanova, S.K., et al., Insights into epidemiology of human parvovirus

B19 and detection of an unusual genotype 2 variant, Bulgaria, 2004 to

2013. Euro Surveill, 2016. 21(4): p. 1560-7917.



13.



Iwalokun, B.A., et al., A study on the association between parvovirus

B19 infection, serum tumour necrosis factor and C-reactive protein

levels among Nigerian patients with sickle cell anaemia. Singapore

Med J, 2012. 53(11): p. 726-31.



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

3 Phương pháp nghiên cứu

Tải bản đầy đủ ngay(0 tr)

×