Tải bản đầy đủ - 0 (trang)
a. Phá bỏ màng tế bào và (màng nhân)

a. Phá bỏ màng tế bào và (màng nhân)

Tải bản đầy đủ - 0trang

Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



chloroform và isoamylalcohol theo tỉ lệ thể tích 25:24:1. Phenol có tác dụng làm biến tính

protein và khơng hòa tan nucleic acid. Chloroform cũng có tác dụng làm biến tính protein

nhưng nó còn có tác dụng loại bỏ hồn tồn phenol ra khỏi phần dung dịch có chứa DNA.

Isoamylalcohol giúp ởn định giữa hai pha nước và pha chloroform.

Trong các phương tách chiết DNA thì phương pháp sử dụng phenol:

chloroform là phương pháp cơ bản. Ở nhiệt độ thường phenol ở dạng tinh thể rắn (tan chảy ở

80 °C) nhưng khi lẫn với khoảng 20% nước (v/v) thì phenol ở dạng nhũ tương gồm các phân

tử phenol ở giữa với các phân tử nước vây quanh. Khi pha hỗn hợp này vào dịch tế bào, các

phân tử phenol có tính kị nước nên có khuynh hướng liên kết vào vùng kị nước của protein ở

bên trong cấu trúc của các phân tử này, kết quả làm protein trương phồng lên và lộ xuất nhóm

bên kị nước (của gốc amino acid) ra ngồi. Các nhóm kị nước này của protein khi đó kết hợp

với nhau tạo thành kết tủa gồm nhiều phân tử protein khác nhau. Trong khi đó DNA vẫn tiếp

tục là chất tan trong nước, dựa vào tính chất này có thể phân tách DNA và protein nhờ vào kĩ

thuật li tâm.

Tủa nucleic acid

Mục đích của việc tủa là nhằm thu nhận acid nucleic dưới dạng cô đặc, một

mặt nhằm bảo vệ chúng khỏi sự phân hủy của các enzyme, mặt khác để có thể hòa tan chúng

lại trong dung dịch theo các nồng độ mong muốn. Hai cách tủa thông thường là:

c.



-



Tủa trong ethanol: việc tủa này được thực hiện trong mơi trường có lực ion cao (nồng độ muối

cao), và nồng độ ethanol cao (2,5 thể tích ethanol:1 thể tích mẫu), nhiệt độ thấp thuận lợi cho

việc tủa.

- Tủa trong isopropanol: điểm khác biệt so với phương pháp trên là khơng

cần sự hiện diện của muối, thể tích isopropanol: thể tích mẫu = 0,8-1





CÁCH TIẾN HÀNH:



- Hút 1,5 ml dịch tế bào vi khuẩn cho vào eppendorf. Ly tâm 6000

vòng/phút trong 10 phút. Thu cặn tủa.



38



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



- Hòa cặn tủa trong 500 µl dung dịch TE 1X, bở sung thêm 50 µl NaCl 0,5

M và 50 µl SDS 10 %. Huyền phù nhẹ nhàng. Ủ hỗn hợp ở 65 0C trong 10 phút. Chuyển hỗn

hợp sang ủ trên đá trong 5 phút.

- Thêm một thể tích dung dịch phenol:chloroform vào hỗn hợp trên. Lắc

mạnh bằng vortex trong 30 giây.

- Ly tâm 12000 vòng/phút trong 10 phút, ở 4 0C. Thu lấy phần dịch phía trên

(là pha nước có chứa DNA), nhẹ nhàng chuyển sang một eppenforf khác.

- Thêm một thể tích dung dịch chloroform, Lắc mạnh bằng vortex trong 30

giây.

- Ly tâm 12000 vòng/phút trong 10 phút, ở 4 0C. Thu lấy phần dịch phía trên

(là pha nước có chứa DNA), nhẹ nhàng chuyển sang một eppenforf khác.

- Thêm 50 µl dung dịch NaCl 0,5M. Bở sung 2-2,5 thể tích ethanol tuyệt

đối lạnh (hoặc 0,8-1 thể tích isopropanol). Ủ ở -200C trong 1-2 giờ.

- Ly tâm 12000 vòng/phút, trong 30 phút, ở 40C. Thu cặn tủa.

- Thêm 500 µl dung dịch ethanol 70% để rửa tủa. Ly tâm 12000 vòng/phút

trong 5 phút, ở 40C. Thu cặn tủa. Để khơ.

- Hòa tủa trong dung dịch TE 1X, bảo quản dịch DNA ở -200C.

Sau đó lấy dịch DNA thu được ở trên làm PCR để xác định KG.

2.4.



QUI TRÌNH PCR PHÁT HIỆN GEN KHÁNG KHÁNG SINH :

2.4.1. MỤC ĐÍCH:



Phát hiện các gen đặc hiệu mã hóa tính kháng kháng sinh của vi khuẩn. (ví dụ:

multiplex PCR phát hiện đồng thời Lyta , gen kháng penicillin (phát hiện thay đổi gen pbp1a ,

pbp2x , và pbp2b ), và các gen kháng macrolide [ erm ( B ) và mef (A )]) [10].

2.4.2. PHẠM VI ÁP DỤNG



39



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



Phát hiện một số gen kháng kháng sinh của các vi khuẩn Gram âm từ các chủng

vi khuẩn gây bệnh phân lập được từ các bệnh phẩm lâm sàng, các vụ dịch, và ở môi trường

ngoại cảnh.

Ta có: Sức đề kháng của S. pneumoniae với penicillin đã được chứng minh là

có liên quan chặt chẽ với đột biến khảm trong pbp1a , pbp2b , vàpbp2x gen. Kháng macrolid

thường là qua trung gian của hai cơ chế: methyl hóa 23S rRNA được mã hóa bởi erm (B) gen

hoặc bơm nhóm macrolid ra ngồi thơng qua MEF (A) gen(1). Ở đây, sẽ dùng multi-PCR

nhằm xác định các gen này.

2.4.3. NGUYÊN TẮC

Sử dụng các đoạn mồi đặc hiệu để khuếch đại một số đoạn gen kháng kháng

sinh của vi khuẩn bằng phản ứng chuỗi gen. Quá trình này được lặp lại nhiều lần để tổng hợp

hàng triệu bản sao của đoạn gen từ một vài phân tử ADN ban đầu qua đó có thể phát hiện

được các đoạn gen dưới đèn UV sau khi điện di.

Ngồi ra: Để có thể xác nhận lại các kỹ thuật mPCR, tất cả chủng đã được thử

nghiệm bởi mPCR cũng đã được kiểm tra sự hiện diện của các gen kháng riêng lẽ bởi một

phản ứng PCR đơn sử dụng các điều kiện PCR như trong đề cập. Các kết quả của hai phương

pháp mà phù hợp nhau hoàn toàn, cho thấy các cặp mồi phản ứng multiplex PCR là đáng tin

cậy.

Yêu cầu đối với mồi phát hiện (detecting primers):



Tính chun biệt



Thời gian của các chu trình vừa đủ để tởng hợp sản phẩm cần thiết



Trình tự của sản phẩm phải vừa đủ cho sự chuyên biệt nhưng không quá

dài.



2.4.4. ĐỐI TƯỢNG [10]:

- Vsv: Streptococcus pneumoniae

- Nguồn lấy mẫu: đờm, mủ…(từ đường hô hấp)



40



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



- Dùng các chủng S. pneumoniae sau quá trình sàng lọc bởi sự nhạy cảm optochin và độ

hòa tan mật;

- Xử lí: mẫu đờm được pha loãng 1:100 và tỷ lệ 1/10.000 với 0,45% natri clorua và được

xử lí bằng dung dịch Sputazyme (Kyokuto Pharmaceutical Industries Co ., Ltd, Tokyo, Nhật

Bản). Các mẫu pha loãng đã được trải trên đĩa thạch máu cừu 5% và sau đó ủ ở 37 ° C trong

5% CO 2 .



2.4.5. TRANG THIẾT BỊ-HĨA CHẤT-SINH PHẨM

2.4.5.1. Thiết bị, hóa chất: tương tự như trong phần trình bày kỹ thuậtt PCR nói

chung

2.4.5.2. Sinh phẩm hóa chất [11]:

- PCR mồi

Một bộ mồi cho PCR, được thiết kế nhằm phát hiện: gen pbp khơng thay đởi gì dựa trên

trình tự pbp của vi khuẩn Streptococcus pneumoniae R6 nhạy cảm penicillin G cho PBP1A,

2X, 2B, gen kháng nhóm macrolid MEF (A) và erm (B); gen autolysin ( Lyta ) khi sàng lọc

của S. pneumoniae.

Trình tự của mồi sử dụng cho phản ứng PCR như sau:

Lyta : 5'- 681 CAACCGTACAGAATGAAGCGG

TTATTCGTGCAATACTCGTGCG 978 -3’;



701



-3



',



5'-



999



pbp1a : 5'- 2256 AAACAAGGTCGGACTCAACC 2275 -3 ', 5'- 2450 AT

ATACATTGGTTTATAGTAAGTT 2427 -3’;

pbp2x : 5'- 1255 CCAGGTTCCACTATGAAAGTG 1275 -3 ', 5'- 1451 ATC

CCAACGTTACTTGAGTGT 1431 -3’;

pbp2b : 5'- 1566 CCTA TATGGTCCAAACAGCCT 1586 -3 ', 5'- 1693 GGTCAATTC

CTGTCGCAGTA 1712 -3’;

MEF (A): 5'- 180 CTGTATGGAG

CCCAGCTTAGGTATACGTAC 562 -3’;



CTACCTGTCTGG



199



-3



',



5'-



581



41



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



erm (B): 5'- 721 CGTACCTTGGATATT

GTAAACAGTTGACGATATTCT CG 922 -3 '.



GVHD:Ths. PhạmTrần Vĩnh Phú



CACCG



740



-3



',



5'-



944



• Ngồi ra:

NaCl

Dung dịch đệm TAE 10X

Nước cất

Thạch điện di (electrophoresis agar)

Thang chuẩn ADN 100bp

Ethidiumbromide

2.4.6. TIẾN HÀNH KỸ THUẬT PCR

2.4.6.1. Chuẩn bị hỗn hợp phản ứng PCR [11]

2.4.6.1.1.

Cách pha mồi (primers) cho phản ứng PCR:

Mồi oligonucleotide để phát hiện ba gen pbp được thiết kế để khuếch đại các bộ

phận(phần) của gen pbp1a , 2x và 2b chỉ trong những chủng nhạy cảm. Những bộ phận này

được đặt vào trong các đơn vị của các chuỗi phân nhánh cao được xác định trong gen khảm

pbp của S. pneumoniae không nhạy cảm penicillin .

Một hỗn hợp mồi A có mồi để phát hiện Lyta và gen pbp1a, hỗn hợp mồi B có mồi để

phát hiện gen pbp2x và 2b, và hỗn hợp mồi C chứa mồi cho phát hiện gen mef (A) và erm (B).

Mỗi hỗn hợp mồi: có 100 μL, trong đó:

• Mồi: 0,1 μM mỗi mồi;

• dNTPs: 8 mM;

m: 50 l ca 10 ì m PCR có: 50 mM KCl, 10 mM Tris-HCl pH 8.4, 1.5 mM

MgCl2;



42



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án cơng nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



• Enzyme: 20 U của Tth DNA polymerase;

• Nước: 348 μl của dH2O, được thêm vào mỗi hỗn hợp mồi.

• Sau đó, nó được chia thành các phần phân ước 30 μl và bảo quản ở -30 ° C.

2.4.6.1.2.



Điều kiện PCR



- Một khuẩn lạc duy nhất của S. pneumoniae phát triển trên một đĩa thạch máu đã được

huyền phù trong 30 μl dung dịch ly giải. Các thành phần của dung dịch ly giải đã được báo

cáo trước đây. Các ống nghiệm với các dd ly giải đã được thiết lập thành một chu trình nhiệt

(GeneAmp 9700; PE Applied Biosystems, Foster City, California, Hoa Kỳ) và ủ ở 60 ° C trong

10 phút và 94 ° C trong 5 phút. Những lysates sau đó được sử dụng như là một DNA mẫu cho

PCR.

- Tiếp theo, 2 μl của lysate vi khuẩn được thêm vào mỗi ba ống có chứa các hỗn hợp mồi

A, B và C. Một kiểm sốt dương tính và âm tính đã được bao gồm trong mỗi lần chạy.

- PCR được thực hiện với chu trình nhiệt trong: 30 chu kỳ ở 94 ° C trong 15 giây, 30 chu

kỳ ở 53 ° C trong 15 giây và 30 chu kỳ 72 ° C trong 15 giây.

- Sau khi khuếch đại, 10 μl của mỗi của ba sản phẩm PCR được điện di trên agarose gel

3% (Agarose LE; Promega Công ty Madison, WI, Mỹ) trong 40 phút ở 100 V.

- Chú ý: Tất cả các mồi sử dụng cho mPCR có nhiệt độ ủ gần như giống hệt nhau, làm

giảm sự xuất hiện của các băng khơng mong muốn có nguồn gốc từ khuếch đại không đặc

hiệu.

2.4.6.2.



Thực hiện phản ứng PCR trên máy ln nhiệt [11]



Các bước



Nhiệt đợ



Thời gian



Biến tính



940C



5 phút



Biến tính



940C



15 giây



43



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



Gắn mồi



GVHD:Ths. PhạmTrần Vĩnh Phú



530C



15 giây



30 chu



kỳ

Tổng hợp



720C



15 giây



Kết thúc



720C



5 phút



2.4.6.3.



Điện di sản phẩm PCR [12]:



Tóm tắt:

Chuẩn bị gel agarose 3% [11]:



Cần cho đủ lượng thạch (agar) vào dung dịch TAE 1X, lắc đều và đun hòa tan

thạch bằng lò vi sóng.

Để thạch nguội khoảng 50-60oC đổ khuôn tạo gel.





Nhỏ mẫu:





Đặt bản gel vào buồng điện di có dung dịch đệm TAE 1X.







Rỏ 10µl thang ADN chuẩn 100bp và các sản phẩm PCR vào các giếng thạch.



Chạy điện di: Chạy điện di ở hiệu điện thế 100V trong vòng 40 phút.

Nhuộm và chụp ảnh gel:



Nhuộm gel trong dung dịch ethidium bromide (0.5 μg/ml) trong 30 phút rồi rửa

bằng nước cất trong 15 phút(2).





Soi và chụp ảnh gel bằng máy chụp gel BioDoc-itTM System.

2.4.6.4.



PHÂN TÍCH KẾT QUẢ



Có vạch trên gel và đúng kích thước khi so sánh với thang ADN chuẩn vạch có

hình ảnh rõ nét, đẹp.

Ví dụ: ta có kết quả điện di như hình sau[11];



44



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



Kết quả của các đoạn DNA khuếch đại kiểm sốt dương tính bao gồm trong bộ (giếng 13) và ba chủng thử nghiệm (giếng 4-12). Đánh dấu PCR (Promega) đã được sử dụng như tiêu

chuẩn kích thước trong giếng được đánh dấu 'Mr' (thang chuẩn). Sản phẩm PCR của Lyta (sản

phẩm 319 bp) và pbp1a (sản phẩm 195 bp ) được thể hiện trong giếng 1, 4, 7 và 10. Sản phẩm

của pbp2x (sản phẩm 197 bp ) và pbp2b (sản phẩm 147 bp ) được thể hiện trong giếng 2, 5, 8

và 11. mef (A) (sản phẩm 402 bp ) và erm (B) (sản phẩm 224 bp ) được thể hiện trong giếng 3,

6, 9 và 12.

-



Nếu vạch mờ, không rõ:



o Tăng thể tích điện di.

o Thực hiện lại phản ứng PCR.

Các mẫu xét nghiệm được xác định dương tính khi xuất hiện các vạch có kích

thước tương ứng với các mẫu chứng và thang chuẩn ADN, ghi: (+).

ghi (-).



Các mẫu khơng có vạch hoặc có vạch khơng đúng kích thước được coi là âm tính,



TÀI LIỆU THAM KHẢO



1.



George M. Eliopoulos, S.E., Mechanisms of Resistance to Macrolides



45



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Đồ án công nghệ 1



GVHD:Ths. PhạmTrần Vĩnh Phú



and Lincosamides: Nature of the Resistance

Elements and Their Clinical Implications. at Wageningen UR Library, December 12, 2012

2.



Praharaj, S.S.a.I., Glycopeptide Resistance in Gram-Positive Cocci: A Review. Hindawi Publishing

Corporation, 2012.



3.



Jeff Pootoolal, J.N., and Gerard D. Wright, GLYCOPEPTIDEANTIBIOTICRESISTANCE. annualreviews, 2002.



4.



Hương, T.P.L.T. Phế Cầu Khuẩn S.pneumoniae. Available from: http://www.nihe.org.vn/new-vn/thuongquy-va-huong-dan-ky-thuat/147/Phe-Cau-Khuan-%20Spneumoniae.vhtm.



5.



Cảnh, T.B.T.Q. Phế cầu khuẩn (Streptococcus pneumoniae). Khoa Xét nghiệm - HMTU; Available from:

http://xetnghiemdakhoa.com/diendan/showthread.php?tid=675.



6.



Hương, P.T.P.L.T. QUI TRÌNH NUÔI CẤY PHÂN LẬP VI KHUẨN Streptococcus pneumoniae. Available from:

http://www.nihe.org.vn/new-vn/dao-tao-ngan-han--tap-huan-412312272/992/Qui-trinh-nuoi-cayphan-lap-vi-khuan-Streptococcus-pneumoniae.vhtm.



7.



Franklin R. Cockerill, I., MD, Performance Standards for Antimicrobial



Susceptibility Testing; Twenty-First

Informational Supplement 2011.

8.



; Available from: http://svdanang.com/threads/tao-va-ung-dung-cua-tao-nguyennaly.917/.



9.



Vân, N.T.B., Bài giảng thí nghiệm cơ sở di truyền và công nghệ gen. 2010.



10.



Kazuko Y. Fukushima1, K.Y., *, Yoichi Hirakata2, Kazuyuki Sugahara1, Yoshitomo Morinaga1,2, Shigeru

Kohno2 and Shimeru Kamihira1. Rapid Identification of Penicillin and Macrolide Resistance Genes and

Simultaneous Quantification of Streptococcus pneumoniae in Purulent Sputum Samples by Use of a

Novel Real-Time Multiplex PCR Assay. 2008; Available from: http://jcm.asm.org/content/46/7/2384.



11.



Nagai K, S.Y., Hasegawa K, Davies TA, Jacobs MR, Ubukata K, Appelbaum PC. Evaluation of PCR primers

to screen for Streptococcus pneumoniae isolates and beta-lactam resistance, and to detect common

macrolide resistance determinants. 2001; Available from:

http://www.ncbi.nlm.nih.gov/pubmed/11733479.



12.



LONG, Đ.Đ., các kỹ thuật cơ bản trong sinh học phân tử. 2012.



46



SVTH: Thị Nhi, Thị Nhung,Khánh Phương, Ngọc Sinh- lớp 10SH



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

a. Phá bỏ màng tế bào và (màng nhân)

Tải bản đầy đủ ngay(0 tr)

×