Tải bản đầy đủ - 0 (trang)
PHẦN 3 NỘI DUNG - VẬT LIỆU - PHƯƠNG PHÁP NGHIÊN CỨU

PHẦN 3 NỘI DUNG - VẬT LIỆU - PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ - 0trang

PHẦN 3

NỘI DUNG - VẬT LIỆU - PHƯƠNG PHÁP NGHIÊN CỨU

3.1. ĐỊA ĐIỂM NGHIÊN CỨU

- Mẫu bệnh phẩm được lấy tại các trại chăn nuôi lợn thuộc 14 tỉnh đại

diện cho ba miền tại Việt Nam gồm: miền Bắc (Thái Ngun, Hà Nội, Hòa

Bình, Bắc Ninh, Hưng n, Hải Dương, Hải Phòng), miền Trung (Hà Tĩnh,

Quảng Trị, Thừa Thiên Huế, Quảng Nam), miền Nam (Bình Dương, Tiền

Giang và Vĩnh Long).

- Nghiên cứu được tiến hành tại phòng thí nghiệm bộ môn Vi sinh vật –

Truyền nhiễm, khoa Thú y Học viện Nơng nghiệp Việt Nam; Trung tâm chẩn

đốn Thú y Trung ương, Cục Thú y.

- Giải trình tự gen được thực hiện tại Công ty 1st BASE, Singapore.

3.2. THỜI GIAN NGHIÊN CỨU

Nghiên cứu được tiến hành từ tháng 6 năm 2015 đến tháng 3 năm 2019.

3.3. VẬT LIỆU NGHIÊN CỨU

- Mẫu nghiên cứu: mẫu thí nghiệm được thu thập ở cả lợn ốm và lợn khỏe

bình thường. Mẫu được bảo quản ở -20oC cho tới khi kiểm tra. Ngoài ra, trong

nghiên cứu về sự lưu hành của một loài virus mới (PCV3) đồng nhiễm với PCV2,

một số mẫu hồi cứu từ năm 2011 đã được sử dụng

- Hóa chất dùng tách và tinh sạch ADN/ARN tổng số gồm: sử dụng kit

TacoTM DNA/RNA Extraction Kit.

- Sinh phẩm, hóa chất dùng cho phản ứng PCR: hot start PCR kit (iStarMaster, iNtRON Biotechnology, Hàn Quốc).

- Trình tự gen tham chiếu: Danh sách các trình tự gen ORF2 của các chủng

PCV2 phân lập ở Việt Nam (Phụ lục 2) và của các chủng phân lập trên thế

giới được công bố trên ngân hàng gen (Phụ lục 3).

- Các trang thiết bị khác (tủ lạnh, nồi hấp, máy PCR, máy li tâm...) của

phòng thí nghiệm được sử dụng phục vụ nghiên cứu.

- Mồi phát hiện: các cặp mồi sử dụng để phát hiện các virus nghiên cứu tại

bảng 3.1.



33



Bảng 3.1. Mồi sử dụng để phát hiện các virus nghiên cứu

Cặp mồi

PCV3-1-F



Trình tự mồi (5’ - 3’)



Kích thước

(bp)



TTACTTAGAGAACGGACTTGTAACG



PCV3-1-R



AAATGAGACACAGAGCTATATTCAG



PCV2-F



AAGGGCTGGGTTATGGTATG



PCV2-R



CGCTGGAGAAGGAAAAATGG



PPV1-F



AGTTAGAATAGGATGCGAGGAA



649



Ku et al.,

2017



353



Yang et al.,

2012



265

PPV1-R



AGAGTCTGTTGGTGTATTTATTGG



PPV2-F



GCGCATTCGCCAAACTAGCTC



Tham khảo



Saekhow

and Ikeda,

2015



199

PPV2-R



GTTTGCCCTTAATGCGATCC



PPV3-F



GTGGCAGTGATATTGCATCG



PPV3-R



TGGCAGTCATTGAATGGAAA



PPV4-F



ACAAGGTGGAGGAACGTTTG



PPV4-R



TTCCATGAGGGAGAGGATTG



TTV1-F



CGGGTTCAGGAGGCTCAAT



TTV1-R



GCCATTCGGAACTGCACTTACT



TTV2-F



TCATGACAGGGTTCACCGGA



TTV2-R



CGTCTGCGCACTTACTTATATACTCTA



PRRS-F



ATGATG RGC TGG CAT TCT



PRRS- R



ACA CGG TCG CCC TAA TTG



PRRS- P



FAMTGT GGT GAA TGG CAC TGA TTG

ACA - BHQ1



247



239



305



252



Martı́nez-



Guinó et al.,

2009



Kleiboeker

et al., 2005



- Cặp mồi đặc hiệu CV1/CV2 & CV3/CV4 dùng cho giải trình tự gen

PCV2 (Fenaux et al., 2000).



34



Bảng 3.2: Trình tự mồi dùng chẩn đốn và giải trình tự gen PCV2

Mồi

Loại

xi/ngược mồi

CV1



Trình tự mồi (5’ - 3’)



Kích

thước

(bp)



AGGGCTGTGGCCTTTGTTAC



Vị trí

nucleotide



Tài liệu

tham

khảo



1329-1348

989



CV2

CV3



Giải

trình

tự



TCTTCCAATCACGCTTCTGC



530-549



Fenaux



TGGTGACCGTTGCAGAGCAG



452–471



2000



et al.,



1092

CV4



TGGGCGGTGGACATGATGAG



1525–1544



- Cặp mồi dùng giải trình tự gen PCV3 được tham khảo theo nghiên cứu

trước đây (Ku et al., 2017).

Bảng 3.3. Trình tự mồi dùng giải trình tự gen PCV3



PCV3-genome-1-F



Kích

thước

(bp)



Trình tự (5’ - 3’)



Primer



Tài liệu

tham

khảo



TAGTATTACCCGGCACCTCGGAACC

1257 bp



PCV3-genome-1-R ACAGGTAAACGCCCTCGCATGTGGG

PCV3-genome-2-F



Ku et al.,

2017



TTGCACTTGTGTACAATTATTGCG

1075 bp



PCV3-genome-2-R ATCTTCAGGACACTCGTAGCACCAC



3.4. NỘI DUNG NGHIÊN CỨU

- Xác định sự lưu hành của PCV2 ở lợn nuôi tại Việt Nam

- Xác định đặc điểm dịch tễ học phân tử của PCV2 lưu hành ở lợn nuôi tại

Việt Nam.

- Xác định sự đồng nhiễm của PCV2 với một số virus (TTV, PPV, PCV3,

PRRS) ở lợn nuôi tại Việt Nam.

3.5. PHƯƠNG PHÁP NGHIÊN CỨU

3.5.1. Phương pháp tính tốn dung lượng mẫu

Để phát hiện tỷ lệ lưu hành PCV2 ở lợn nuôi tại Việt Nam, thiết kế lấy mẫu

bệnh phẩm nghiên cứu bằng phương pháp lấy mẫu ngẫu nhiên đơn giản, nhiều

giai đoạn để thu thập mẫu bao gồm các tầng/giai đoạn như sau:

35



* Bước 1: Chọn tỉnh lấy mẫu

Chúng tơi chọn có chủ đích 14 tỉnh đại diện cho cả 3 miền Bắc, Trung,

Nam vì một số lý do sau:

- Là các tỉnh có tổng đàn lợn với số lượng lớn.

- Là các tỉnh được xác định là có nguy cơ cao (do đã từng xác định có

mầm bệnh lưu hành, là địa phương có đường quốc lộ đi qua, là địa phương có

nhu cầu và mức độ tiêu thụ lợn với số lượng lớn).

- Là địa phương có hệ thống thú y và sự hợp tác tốt để bảo đảm việc tổ

chức triển khai được thành cơng và có hiệu quả.

* Bước 2: Tính số lượng xã cần phải lấy mẫu

Số lượng xã cần phải lấy để giám sát xác định mức độ lưu hành PCV2 trên

lợn theo cơng thức:



n1 = z 2 ×



Ρ × (1 − Ρ )

e2



Trong đó:

n1: Số xã cần lấy.

P: Là tỷ lệ lưu hành ước tính ở cấp độ xã/trang trại chăn nuôi là 25% (dựa

vào số liệu tổng quan các nghiên cứu từ năm 2000 – 2018 đã tổng hợp được tỷ lệ

lưu hành ước tính ở cấp độ trại).

z = 1.96, tương đương với độ tin cậy 95%.

e = Sai số tuyệt đối giữa giá trị ước tính so với mức độ lưu hành thực tế.

Trong nghiên cứu này, chúng tôi chọn sai số (e) = 10%.

Tổng số lượng đàn lợn là 10.000 hộ chăn nuôi lợn.

Dựa vào công thức trên, tổng số xã cần lấy mẫu là 72 xã, chúng tơi làm tròn

là 70 xã vì đã lựa chọn có chủ đích 14 tỉnh. Do đó, mỗi tỉnh cần lấy mẫu ở 05 xã.

* Bước 3: Tính số lượng cơ sở chăn ni lợn cần phải lấy mẫu

Số lượng cơ sở cần phải lấy để giám sát xác định mức độ lưu hành PCV2

trên lợn theo cơng thức:



n1 = z 2 ×



Ρ × (1 − Ρ )

e2



Trong đó:

36



n1: Số cơ sở cần lấy.

P: Là tỷ lệ lưu hành ước tính ở cấp độ mẫu là 7% (dựa vào số liệu tổng

quan các nghiên cứu từ năm 2000 – 2018 đã tổng hợp được tỷ lệ lưu hành ước

tính ở cấp độ mẫu được lấy ngẫu nhiên để xét nghiệm bệnh).

z = 1.96, tương đương với độ tin cậy 95%.

e = Sai số tuyệt đối giữa giá trị ước tính so với mức độ lưu hành thực tế.

Trong nghiên cứu này, chúng tôi chọn sai số (e) = 10%.

Tổng số lượng đàn lợn là 10.000 hộ chăn nuôi lợn

Dựa vào công thức trên, tổng số mẫu cần lấy ở mỗi xã là 25 mẫu. Do mỗi

tỉnh cần lấy mẫu ở 05 xã, nên tổng số mẫu cần lấy ở mỗi tỉnh là 5 x 25 = 125 mẫu.

Kết quả tính tốn dung lượng mẫu được trình bày ở bảng 3.4.

Bảng 3.4. Tổng hợp tình hình lấy mẫu nghiên cứu



TT



Tỉnh



Số xã cần

lấy mẫu



Số cơ sở

cần lấy

mẫu/1 xã



Số mẫu

cần lấy/1

cơ sở



(a)



(b)



(c)



Tổng số

mẫu xét

nghiệm



Mẫu

gộp thí

nghiệm



1



Bắc Ninh



5



5



5



125



25



2



Hải Dương



5



5



5



125



25



3



Hòa Bình



5



5



5



125



25



4



Hà Nội



5



5



5



125



25



5



Hải Phòng



5



5



5



125



25



6



Hưng Yên



5



5



5



125



25



7



Thái Nguyên



5



5



5



125



25



8



Hà Tĩnh



5



5



5



125



25



9



Quảng Trị



5



5



5



125



25



10



Huế



5



5



5



125



25



11



Quảng Nam



5



5



5



125



25



12



Bình Dương



5



5



5



125



25



13



Tiền Giang



5



5



5



125



25



14



Vĩnh Long



5



5



5



125



25



Tổng số



70



70



70



1.750



350



Ghi chú: (a) Giai đoạn 1: lựa chọn số xã; (b) Giai đoạn 2: lựa chọn số cơ sở nuôi; (c) Giai đoạn 3: tính số mẫu

cần lấy. Tổng số mẫu xét nghiệm = Số xã cần lấy mẫu x Số cơ sở cần lấy mẫu/1 xã x số mẫu cần lấy/1 cơ sở.



37



Với đặc điểm chăn nuôi lợn nhỏ lẻ chiếm đa số (trên 70%, theo số liệu

thống kê của các tỉnh), do đó để tăng cơ hội phát hiện được bệnh, chúng tôi quyết

định tại mỗi xã, lấy 25 mẫu tại 05 cơ sở, hộ chăn nuôi lợn, mỗi hộ tiến hành lấy

05 mẫu đủ để gộp thành 01 mẫu xét nghiệm. Như vậy, mỗi cơ sở ni chỉ có 1

mẫu xét nghiệm do đó chúng tơi sử dụng tỷ lệ dương tính với PCV2 tại các cơ sở

ni để tiến hành đánh giá tỷ lệ lưu hành PCV2 ở lợn tại các tỉnh nghiên cứu.

3.5.2. Phương pháp điều tra hồi cứu

Khi giải trình tự gen và phân tích cây phát sinh loài của virus PCV2, điều

tra ngược lại các mẫu đã được xét nghiệm trong phòng thí nghiệm.

3.5.3. Phương pháp thu thập mẫu

Mẫu huyết thanh: được lấy ngẫu nhiên từ lợn khỏe mạnh hoặc có triệu

chứng PCVAD (tiêu chảy, có triệu chứng hơ hấp, còi cọc…). Dùng seringe lấy

máu tĩnh mạch tai hoặc vịnh tĩnh mạch cổ, để 1 - 2 giờ cho máu đông tự nhiên

(hoặc để 1 giờ ở 37oC), sau đó để qua đêm ở 4oC. Tiến hành chắt huyết thanh vào

ống eppendorf và bảo quản ở -20oC cho đến khi kiểm tra.

Mẫu dịch hầu họng: sử dụng dây cotton (đã xử lý bằng hấp khử trùng

121 C, sấy khơ) có khả năng thấm nước tốt, treo ngang tầm vai của lợn. Thời

gian đặt giây đảm bảo tất cả lợn trong ơ ni có thể tiếp cận và nhai được dây.

Sau đó, dây cotton được thu lại và vắt dịch xoang miệng trực tiếp vào túi zip vô

trùng. Tiến hành hút dịch xoang miệng vào ống eppendorf và bảo quản ở -20oC

cho đến khi kiểm tra.

o



Mẫu phủ tạng: gồm gan, hạch amidan, hạch lympho, thận, lách, phổi, ruột

của lợn có triệu chứng PCVAD (tiêu chảy, có triệu chứng hơ hấp, còi cọc…).

Bệnh tích khi mổ khám thường quan sát được là hạch lympho sưng, xuất huyết;

phổi viêm. Mẫu thu được sẽ được tiến hành đồng nhất mẫu và bảo quản ở -20oC

cho đến khi kiểm tra.

3.5.4. Phương pháp chiết tách ADN/ARN

Sử dụng bộ kit TacoTM DNA/RNA Extraction Kit và máy chiết tách nucleic

acid tự động TacoTM. Các bước như sau:

- Chuẩn bị:

+ Thêm 135ml cồn 96o vào dung dịch Washing buffer A, lắc đều.

+ Thêm 230ml cồn 96o vào dung dịch Washing buffer B, lắc đều.

38



Chuẩn bị mẫu và thêm các thuốc thử tiếp theo:

+ Cho 250µl cồn 96o và 500µl Lysis buffer vào cột 1 (và 7).

+ Cho 750µl Washing buffer A1 và 50µl Magnetic Bead vào cột 2 (và 8).

+ Cho 750µl Washing buffer A vào cột 3 (và 9).

+ Cho 750µl Washing buffer B2 vào cột 4 (và 10).

+ Cho 750µl Washing buffer B vào cột 5 (và 11).

+ Cho 100µl Eluting Buffer vào cột 6 (và 12).

+ Cho 200µl mẫu tách chiết đã chuẩn bị ở trên vào cột 1 (và 7).

+ Đưa vào hệ thống chiết tách nucleic acid tự động TacoTM để chạy (khoảng

50 phút).

+ Dùng pipet hút 90µl ADN/ARN ở các giếng cột 6 (và 12) vào ống

eppendorf mới và bảo quản ở -20oC cho đến khi kiểm tra.

3.5.5. Phương pháp Realtime PCR

Áp dụng theo phương pháp Realtime PCR của Trung tâm chẩn đoán Thú y

Trung ương, các phép thử chẩn đốn xét nghiệm PRRS, PCV2 đã được cơng

nhận ISO/IEC 17025:2005, bao gồm:

- Chuẩn bị hỗn hợp phản ứng:

Thể tích cho 1 xét nghiệm (µl)

Ngun liệu

PRRS



PCV2



Water



5,5



3,2



2X Buffer



12,5



10



1



1,6



Probe (FAM)



0,5



0,8



Enzyme Mix



0,5



0,4



ADN/ARN mẫu tách chiết



5



4



Tổng cộng



25



20



Primer (06-20 pmol/µl)



+ Sử dụng kít Super Script-III Platinum One-step qRT-PCR.

+ Hỗn hợp master mix và chu trình nhiệt để phát hiện các virus PCV2,

PRRS được chuẩn bị như sau:

39



+ Chuẩn bị mix (hỗn hợp phản ứng) chạy Realtime PCR:

+ Chạy phản ứng: Đặt hỗn hợp phản ứng vào máy Realtime PCR, chọn dye

phù hợp và chạy theo chu trình nhiệt như sau:

AND/ARN virus



Nhiệt độ (oC)



Thời gian (giây)



50a



900a



95a,b



120a; 900b



95a,b



10a, 15b



60a,b



45a; 50b



a



PRRS ;

PCV2b



Chu kỳ

01



40



Kết quả có giá trị khi mẫu đối chứng dương là dương tính, mẫu đối chứng

âm là âm tính.

Nếu mẫu đối chứng dương và âm chiết tách là khơng đúng thì phải thực

hiện chiết tách và nhân gene lại.

Nếu mẫu đối chứng dương và âm nhân gene là khơng đúng thì phải thực

hiện nhân gene lại.

- Đọc kết quả:

+ Mẫu dương tính khi có giá trị Ct ≤ 35, kết luận dương tính.

+ Mẫu nghi ngờ khi có giá trị 35 < Ct ≤ 40, kết luận nghi ngờ.

+ Mẫu âm tính khi khơng có giá trị Ct, kết luận âm tính.

- Trường họp đối với các mẫu nghi ngờ:

Mẫu nghi ngờ phải cần được thực hiện xét nghiệm lại hoặc sử dụng

phương pháp xét nghiệm tương đương khác để khẳng định kết quả:

+ Nếu kết quả xét nghiệm lại là dương tính thì kết luận là dương tính.

+ Nếu kết quả xét nghiệm lại là nghi ngờ thì kết luận là nghi ngờ.

+ Nếu kết quả kiểm tra lại âm tính, thì kết luận là âm tính.

3.5.6. Phương pháp PCR

Trong nghiên cứu này, chúng tơi sử dụng kít PCR thương mại (i-StarMaster,

iNtRON Biotechnology, Hàn Quốc), có các thành phần: PCR buffer, dNTPs,

MgCl2, Taq DNA polymerase như sau: i-Star master mix solution (17µl), Mồi

xi(1µl)/Mồi ngược (1µl), AND/ARN mẫu tách chiết (1µl).

Các bước thực hiện phản ứng và chu trình nhiệt tối ưu của phản ứng PCR

40



được thực hiện theo công bố trước đây (Huỳnh Thị Mỹ Lệ và cs., 2012; Huỳnh

Thị Mỹ Lệ và cs., 2015).

- Chu trình nhiệt phản ứng PCR để phát hiện virus:

Các giai đoạn

của phản ứng



Nhiệt độ (oC)



Thời gian (giây)



Vòng

lặp



Tiền biến tính



94



300



1



Biến tính



94



30



Bắt mồi



55a,b, 54c



30



Kéo dài



72



90



Kéo dài cuối cùng



72



300



40



1



Nhiệt độ gắn mồi phản ứng PCR phát hiện các virus đồng nhiễm như sau: a

(PCV3), b (PPV), c (TTV).

- Chu trình nhiệt của phản ứng PCR để chẩn đốn và giải trình tự PCV2:

Cặp mồi



VF2/VR2d,

CV1/CV2e,

CV3/CV4f



Giai đoạn

phản ứng



Nhiệt độ (oC)



Thời gian (giây)



Số vòng lặp



Tiền biến tính



94



180



1



Biến tính



94



15



Bắt mồi



55d, 61e, 65f



20



Kéo dài



72



30d, 90e, f



Kéo dài cuối cùng



72



300



40



1



Sản phẩm PCR được phân tích bằng phương pháp điện di trong thạch

agarose 2%, có bổ sung lượng thuốc nhuộm phù hợp (RedSafe™ Nucleic Acid

Staining Solution (20,000x)). Đối với sản phẩm PCR phục vụ giải trình tự gen

(nhân lên bởi cặp mồi CV1/CV2, CV3/CV4), sản phẩm PCR được tinh sạch bằng

sạch bằng QIAquick PCR Purification Kit (Qiagen).

3.5.7. Phương pháp giải trình tự và hồn thiện trình tự gen

Sản phẩm PCR tinh sạch được giải trình tự theo hai chiều (xuôi và ngược)

bằng phương pháp Sanger, được thực hiện tại cơng ty 1st BASE (Singapore).

Trình tự nucleotide tiếp tục được phân tích bằng chương trình tin sinh học

BioEdit v7.1.3.0 (Hall, 1999) trên cơ sở đối chiếu so sánh: (i) giữa trình tự

41



nucleotide được giải trình tự theo chiều xi và chiều ngược, và (ii) với trình tự

genome tham chiếu cơng bố trên ngân hàng gen.

3.5.8. Phương pháp phân tích trình tự gen

Dựng cây phát sinh chủng loại bằng Chương trình MEGA 6 (Tamura et al.,

2013) với các tham số:

- Model Kimura-2 parameter mô phỏng sự thay đổi của nucleotide.

- Các vị trí có sự khuyết thiếu nucleotide xuất hiện ở ít hơn 5% tổng số trình

tự sẽ được giữ lại.

- Xây dựng cây bằng phương pháp Neighbor-Joining với số bootstrap là

1000 lần.

3.5.9. Xây dựng cây phát sinh chủng loại

Sử dụng phần mềm MEGA6 để xây dựng cây phả hệ được dựa trên trình tự

gen mã hóa capsid protein (gen ORF2).

Các chủng virus đưa vào cơ sở dữ liệu cho phân tích cây phả hệ gồm:

- Các chủng PCV2 giải trình tự được ở Việt Nam.

- Các chủng tham chiếu thuộc 8 cluster của genetype PCV2a và PCV2b.

- Các chủng PCV2 thu thập từ ngân hàng gen (genbank) mang đột biến

thêm amino acid (lysin) ở đầu C của capsid protein.

3.5.10. Phương pháp nghiên cứu đặc điểm dịch tễ học phân tử theo không

gian - thời gian

Sử dụng phần mềm Quantum GIS để mô tả mức độ và sự phân bố của

PCV2 ở lợn nuôi tại Việt Nam.

Đặc điểm dịch tễ học phân tử của các chủng, PCV2b, PCV2d phân lập được

ở Việt Nam được đi sâu tìm hiểu theo khơng gian (quốc gia) và thời gian (năm

phân lập) nhằm trả lời câu hỏi: nguồn gốc phát sinh từ đâu và lưu hành ở Việt

Nam sớm nhất từ khi nào.

- Cơ sở dữ liệu dùng cho phân tích là 391 trình tự gen ORF2 của các chủng

thuộc genotype PCV2d thu được trong nghiên cứu này hoặc truy cập từ ngân

hàng gen.



42



Bảng 3.5. Tóm tắt thơng tin trình tự gen ORF2 của các chủng PCV2d dùng

phân tích đặc điểm dịch tễ học theo không gian - thời gian

Năm



Châu Âu

Bỉ



Cr



Đức



Italy



Châu Mỹ



Châu Á

Ro



Ser



2003



TQ







Indo



1



HQ



ĐL



TL



Bra



1



2005



2



2006



4



2007



12



2009



Mỹ



1



2004



2008



VN



1

1



1



15



1



22



2010



1



2



2011



1



6



2012

2013



2



2014



3



2



2



1

1



2

3

1



18



6



3



1



9



2



1



30



5



3



24



18



34



1



35



2016



2



4

1



3



2017



5



2



32



2015



1



1



4

3



3



1



3



4



1



6



29



1



5



1



Ghi chú: Croatia (Cr), Romania (Ro), Serbia (Ser), Trung Quốc (TQ), Ấn Độ (AĐ), Indonesia (Indo),

Hàn Quốc (HQ), Đài Loan (ĐL), Thái Lan (TL), Việt Nam (VN), Braxin (Br). Chữ số trong các ơ là số

lượng trình tự gen ORF2 thu thập được tại mỗi quốc gia/ vùng lãnh thổ, tương ứng ở các năm.



- Cơ sở dữ liệu dùng cho phân tích là 617 trình tự gen ORF2 của các chủng

thuộc genotype PCV2b thu được trong nghiên cứu này hoặc truy cập từ ngân

hàng gen.



43



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

PHẦN 3 NỘI DUNG - VẬT LIỆU - PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ ngay(0 tr)

×