Tải bản đầy đủ - 0 (trang)
Kết quả kiểm tra độ đặc hiệu củaprimer

Kết quả kiểm tra độ đặc hiệu củaprimer

Tải bản đầy đủ - 0trang

lượng tự do nhỏ hơn -9 kcal/mole đòi hỏi phải cung cấp một nhiệt độ khá cao mới

có thể phá vỡ chúng.

Bảng 4.2 Kết quả cấu trúc thứ cấp mang năng lượng tự do thấp nhất

Delta G



Tên cấu trúc



Cấu trúc thứ cấp



thứ cấp

Hairpin



(kcal/mol)



GTGATGAGGA

|



(HPF – cysS)



|



0,68



A



TGTGGTGGG

Hairpin



ACAGAGGGTGA

|| |



(HPR – cysS)



2,75



C



CCGAAG

Homo dimer



5'



GGCTTCGTCACCCTCTGT

::



(HPF – cysS)



||



-3,61



::



3' TGTCTCCCACTGCTTCGG

Homo dimer



5'



GTGATGAGGAAGGGTGGTGT



-1,47



: || :



(HPR – cysS)



3' TGTGGTGGGAAGGAGTAGTG

Hetero dimer

(HP - cysS)



5'



TGTCTCCCACTGCTTCGG

:



||||||



-11,01



:



3' GTGATGAGGAAGGGTGGTGT



Kết quả khảo sát các cấu trúc thứ cấp được thể hiện ở bảng 4.2 cho thấy các

cấu trúc thứ cấp kể trên đều có năng lượng tự do lớn hơn -9 kcal/mol nên sẽ không

gây ảnh hưởng đáng kể đến hoạt động của cặp primer trong phản ứng PCR. Chỉ trừ

cấu trúc hetero dimer của HP – cysS có Delta G nhỏ hơn -9 kcal/mol là -11,01

kcal/mol, nhưng liên kết trong cấu trúc này không nằm ở các Nu ở đầu 3’, do đó cấu

trúc thứ cấp này không ảnh hưởng đến hoạt động của cặp primer.



27



Cặp primer được kiểm tra độ đặc hiệu cho H. parasuis bằng cơng cụ BLAST

của NCBI. Chương trình này dò tìm trên cơ sở dữ liệu của các ngân hàng gene để

tìm ra tất cả các gen có trình tự tương đồng với các primer này.



28



Theo kết quả của BLAST, có 100 đoạn gen tương đồng hồn tồn 100%với trình tự cys, dưới đây là 5 đoạn

gen có vịtrí tương đồng hồn tồn với cặp primer cys F, cys R.



STT

1



2



3



4



5



Độ tương



Tên trình tự

H. parasuis isolate HLJ-018 16S ribosomal RNA

gene, partial sequence

H. parasuis strain IT14187-7 16S ribosomal RNA

gene, partial sequence

H. parasuis strain SN10-1 16S ribosomal RNA gene,

partial sequence

H. parasuis strain 05-47309 16S ribosomal RNA

gene, partial sequence

H. parasuis strain 04-100691 16S ribosomal RNA

gene, partial sequence



Số Nu tương đồng



Số ID



đồng



cysSF



cysS R



100%



18/18



20/20



JF927623.1



100%



18/18



20/20



GU226412.1



100%



18/18



20/20



GU226410.1



100%



18/18



20/20



GU226408.1



100%



18/18



20/20



GU226407.1



Bảng 4.3 Kết quả phân tích BLAST của cặp primer

Như vậy, về mặt lí thuyết cặp primer cys F, cys R hoàn toàn đặc hiệu và phù hợp cho phản ứng PCR phát hiện

H. parasuis.



29



4.2 Kết quả xác định nồng độ primer và nhiệt độ bắt cặp tối ưu

Kết quả khảo sát bốn nồng độ primer 0,25µM, 0,5µM, 0,75µM và 1µM ở bốn

nhiệt độ bắt cặp khác nhau 52oC, 54oC, 56oC và 58oC được trình bày qua hình Bảng 4.4

Bảng 4.4Kết quả xác định nồng độ primer và nhiệt độ bắt cặp

Nhiệt độ



T1=52oC



T2=54oC



T3=56oC



T4=58oC



PA = 0,25μM



+



+



+++



+++



PB = 0.05μM



+



++



++++



++++



PC = 0,75μM



+



++



++++



+++



PD = 1.0μM



+



++



++++



++++



Nồng độ primer



+:



band sản phẩmmờ, có band phụ



++:



band sản phẩm dày, có band phụ



+++: band sản phẩm rõ, khơng có band phụ

++++: band sản phẩm sáng, rõ, dày, khơng có band phụ

Bảng 4.4với 16 NT (Nghiệm thức)cho thấy ở sự tác động qua lại giữa các nhiệt

độ bắt cặp và nồng độ primer khác nhau. Sản phẩm PCR của 16 NT trên gel điện di

đều cho kết quả đặc hiệu, sản phẩm PCR có band đúng kích thước 821bp (so với thang

chuẩn100bp) của H. parasuis.

Ở nhiệt độ bắt cặp 52 oC với bốn nồng độ primer 0,25µM, 0,5µM, 0,75µM và

1µM - các NT A1, B1, C1 và D1 đều cho sản phẩm PCR có band mờ, đồng thời có

band phụ (mức độ 1+).

Ở nhiệt độ 54oC, bốn sản phẩm PCR của bốn NT đều có band sản phẩm phụ,

trong đó NT A2 (nồng độ primer 0,25µM) cho band sản phẩm mờ (mức độ 1+),các NT

B2, C2, D2 (ba nồng độ primer còn lại) đều có band sản phẩm dày, rõ (mức độ 2+).



30



Với nhiệt độ bắt cặp 56oC, các nồng độ primer khác nhau - NT A3, B3, C3, D3

đều cho sản phẩm PCR sáng rõ, band dày và khơng có band sản phẩm phụ (mức độ

4+).Do nồng độ primer 0,25µM thấp nên band sản phẩm hơi mờ hơn các nồng độ khác

(mức độ 3+).

Ở nhiệt độ bắt cặp 58oC, NT A4, C4 – với nồng độ primer0,25µM và 0,75 µM –

cho sản phẩm PCR có band sáng, khơng xuất hiện band sản phẩm phụ (mức độ 3+).

Với NT B4, D4 - nồng độ primer 0,5 µM và 1µM, ta được sản phẩm PCR có band sáng

rõ, dày (mức độ 4+).

Từ các kết quả trên, cho thấy NT B3 - nhiệt độ bắt 56oC và nồng độ primer tối ưu

0,5µM, là tốt nhất cho quy trình PCR phát hiện H. parasuis (nồng độ primer thấp, tiết

kiệm hóa chất nhưng vẫn đảm bảo band sản phẩm sáng rõ, đúng kích thước chuẩn của

vi khuẩn H. parasuis, đồng thời khơng có band sản phẩm phụ). Quy trình tối ưu này

được dùng cho việc thử nghiệm tiếp theo.

L



(-)



A1



B1



C1



D1



821 bp

500bp



Hình 4.1 Kết quả khảo sát nồng độ primer ở 52 oC

A1: nồng độ primer 0,25 μM B1: nồng độ primer 0,5 μM

C1: nồng độ primer0,75 μMD1: nồng độ primer 1.0 μM

L:ladder (-) đối chứng âm



31



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Kết quả kiểm tra độ đặc hiệu củaprimer

Tải bản đầy đủ ngay(0 tr)

×