Tải bản đầy đủ - 0 (trang)
Chương 2. MỤC TIÊU, ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Chương 2. MỤC TIÊU, ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ - 0trang

b.



ên cứu tron p òn t í n



-



Ph ng th nghiệm, ph ng tiêu ản



Viện D



liệu. Ph ng tiêu ản th



Ph ng tiêu ản th

tr



ệm p òn t êu bản

liệu, Kho T i nguyên D



liệu,



v t, Viện Sinh th i v T i nguyên Sinh v t,



v t, Bảo t ng Thiên nhiên Việt N m v Bảo t ng th



v t,



ng ại họ Kho họ T nhiên.

-



Ph ng th nghiệm Y D



họ C s , Khoa Y D



, Đại họ Qu



gi H



Nội.

2.2.3. Vật liệu nghiên cứu

V t liệu nghiên ứu ủ

v m u



yt



i ủ



t i l tiêu ản



lo i thứ thuộ



l u gi tại



hi Panax



ph ng tiêu ản



Việt N m thu th p



. Cụ th



nh s u:

Nghiên cứu đặc điểm hình th i:

- 103 s hiệu tiêu ản ủ 5 lo i: Giả nh n s m – P. pseudoginseng Wallich,

Nhân sâm – P. ginseng C.A.Mey., T m thất ho ng – P. stipuleanatus H.T.Tsai et

K.M.Feng, S m vũ



iệp – P. bipinnatifidus Seem. và S m ngọ

l u gi tại



vietnamensis Ha et Grushv.

Nam: Ph ng tiêu ản

ản th



liệu, Viện D



ph ng tiêu ản v



linh – P.



ảo t ng



Việt



liệu (NIMM): 84 tiêu ản; Phòng tiêu



v t, Viện Sinh th i v T i nguyên Sinh v t (HN): 15 tiêu ản; Bảo t ng



Thiên nhiên Việt N m (VNMN): 03 tiêu ản; Tr



ng Đại họ Kho họ T nhiên



(HNU): 01 tiêu ản (Chi tiết xem P ụ lục 3).

- 70



th







lo i thuộ



hi Panax thu th p



8 tỉnh thuộ mi n B



v



Trung ủ Việt N m gồm: L o C i, H Gi ng, S n L , L i Ch u, V nh Ph , Nghệ

An, Quảng N m, Kon Tum. Trong th i gi n từ th ng 7 n m 2014 ến th ng 9 n m

2017. C



m u



l m tiêu ản v i 46 s hiệu tiêu ản (P.01 – P.46).



Giải trình tự ADN và phân tích quan hệ ph t sinh:

- 35 m u l

ng k hiệu v i

và ADN.







m u



thu th p



m u nghiên ứu h nh th i



27



nghiên ứu h nh th i





ng kết n i



trên,



liệu h nh th i



Bảng 2.1. Lý lịch các m u thu th p

Kí hiệu

mẫu NC

STT

hình

thái





hiệu

mẫu

ADN



1



P.01



P.01



2



P.02



P.02



3



P.03



P.03



4



P.04



P.04



5



P.05



P.05



6



P.06



P.06



Bộ phận

Cả y,

hoa

Cả y,

hoa

Cả



y



Cả y,

hoa

Cả y,

ho v quả

non

Cả y,

hoa

Thân khí

sinh và

ụm l

Cả y,

ho v quả

non



7



P.07



P.07



8



P.08



P.08



9



P.09



P.09



Cả y,

hoa



P.10



Cả y,

ụm ho

non



P.11



Cả y,

ho v quả

non



P.12



Cả y,

hoa



P.13



Cả y,

hoa



10



11



12



13



P.10



P.11



P.12



P.13



Số

ượng

mẫu

02

02

01

01

01



02



01



02



01



Địa điểm thu

T k Ngo, Tr Linh, N m

Tr My, Quảng N m

T k Ngo, Tr Linh, N m

Tr My, Quảng N m

T k Ngo, Tr Linh, Nam

Tr My, Quảng N m

T k Ngo, Tr Linh, N m

Tr My, Quảng N m

Th n M ng R ng 2,

Ngọ L y, Tu M R ng,

Kon Tum

Th n M ng R ng 2,

Ngọ L y, Tu M R ng,

Kon Tum

Trà Linh, Nam Trà My,

Quảng N m

Th n 2, M ng L ng, Tr

Linh, Nam Trà My,

Quảng N m

Th n 2, M ng L ng, Tr

Linh, Nam Trà My,

Quảng N m



Ngày thu



06/07/2014

23/07/2014

23/07/2014

23/07/2014

27/07/2014



27/07/2014



28/11/2014



20/07/2015



20/07/2015



01



Th n 2, M ng L ng, Tr

Linh, Nam Trà My,

Quảng N m



20/07/2015



01



Th n 2, M ng L ng, Tr

Linh, Nam Trà My,

Quảng N m



20/07/2015



01



Th n M ng R ng 2,

Ngọ L y, Tu M R ng,

Kon Tum



23/07/2015



01



Th n M ng R ng 2,

Ngọ L y, Tu M R ng,

Kon Tum



23/07/2015



28



14



P.14



P.14



Cả y,

hoa

Cả y,

hoa



01



15



P.15



P.15



16



P.16



P.16



17



P.17



18



P.18



19



P.19



20



P.20



P.20



21



P.21



P.21



22



P.22



P.22



23



P.23



P.23



Cả



y



01



24



P.24



P.24



Cả



y



01



25



P.25



P.25



26



P.26



27



P.27



28



P.28



P.28



29



P.29



P.29



30



P.30



P.30



31



P.31



32



P.32



Cả y

Cả y,

ụm ho

non

Cả y,

hoa

Cả y,

hoa

Cả y,

ụm ho

non

Cả y,

ụm ho

non

Cả y,

quả h n

Cả y



P.32



Cả y,

ho v quả

non

Cả y,

hoa

Cả y,

quả h n

Cả y,

hoa

Cả



y



Cả y,

hoa

Cả y,

hoa



01



01



Th n K xi

L y, Tu M

Tum

Th n K xi

L y, Tu M

Tum

Th n K xi

L y, Tu M

Tum



II, Ngọ

R ng, Kon



24/07/2015



II, Ngọ

R ng, Kon



24/07/2015



II, Ngọ

R ng, Kon



24/07/2017



02



Kon Plong, Kon Tum



27/07/2014



03



Tu M R ng, Kon Tum



27/07/2014



02



Kon Plong, Kon Tum



17/6/2015



01



Sa Pa, Lào Cai



13/07/2015



01



Hồ Thầu, Ho ng Su Ph ,

Hà Giang

Hồ Thầu, Ho ng Su Ph ,

Hà Giang

Hồ Thầu, Ho ng Su Ph ,

Hà Giang

Hồ Thầu, Ho ng Su Ph ,

Hà Giang

Sa Pa, Lào Cai



04



Sa Pa, Lào Cai



16/4/2014



02



Sa Pa, Lào Cai



16/4/2014



02



Sa Pa, Lào Cai



13/07/2015



01



Hồ Thầu, Ho ng Su Ph ,

Hà Giang



12/06/2016



01



Hồ Thầu, Ho ng Su Ph ,

Hà Giang



12/06/2016



03



Hồ Thầu, Ho ng Su Ph ,

Hà Giang

Hồ Thầu, Ho ng Su Ph ,



22/8/2016



01

01



02

29



12/06/2016

12/06/2016

30/05/2017

30/05/2017

08/08/2017



30/05/2017



33



P.33



P.33



34



P.34



35



P.35



P.35



36



P.36



P.36



37

38



P.37

P.38



P.37

P.38



39



P.39



P.39



40



P.40



P.40



41



P.41



P.41



42



P.42



43



P.43



44



P.44



45



P.45



46



P.46



P.46



Cả



y



03



Cả



y



02



Cả y,

hoa

Cả y,

ho v quả

non

Cả y

Cả y

Cả y,

hoa

Cả y,

hoa

Cả y,

hoa

Cả y,

hoa

Cả y,

hoa

Hạt

Cả y,

hoa

Cả y



Hà Giang

Sa Pa, Lào Cai

X n Mần, Ho ng Su Ph ,

Hà Giang

ng Tè, Lai Châu



08/08/2017

2015



01



M



01



S n Hồ, Lai Châu



27/07/2017



01

01



S n Hồ, Lai Châu

S n Hồ, Lai Châu



27/07/2017

27/07/2017



01



M



19/09/2017



ng Tè, Lai Châu



Phu Xai Lai Leng,

M ng L ng, Nghệ An

Phu Xai Lai Leng,

M ng L ng, Nghệ An



01

01



24/04/2017



14/07/2017

29/09/2017



02



Si Ma Cai, Lào Cai



11/8/2014



03



Si Ma Cai, Lào Cai



9/9/2014



01



Si Ma Cai, Lào Cai



19/1/2015



02



Si Ma Cai, Lào Cai



12/8/2016



02



Hồng Su Phì, Hà Giang



30/05/2017



2.3. Nội dung nghiên cứu

(1) X



ịnh th nh phần các loài thứ thuộ



- Thu th p m u v t tại

+ Thu th p







hi Panax L.



i m nghiên ứu



m u ( ả cây) l m tiêu ản



gi tại ph ng tiêu ản. M u t

+ Thu th p m u l hoặ

- Th ng kê, hệ th ng



Việt N m



i



m tả, x



nghiên ứu ặ



ịnh tên kho họ v l u

i m giải ph u.



ầu mầm ho ph n t h ADN.

tiêu ản hiện



- Thu th p một s th ng tin v : ị



tại Ph ng tiêu ản



i m thu m u, sinh th i n i mọ , ặ



thái, ...



30



i m h nh



- Trên



s



m u



thu th p



, ph n t h







i m h nh th i (l , ho ,



quả, hạt v th n rễ).

- Đ i hiếu v i



t i liệu ph n loại hi Panax L. hiện



x



ịnh tên kho



họ .

(2) M tả ặ

- M tả ặ

- Đặ



i m h nh th i

i m h nh th i



i m hung ủ



(3) M tả ặ

- M tả ặ



lo i thứ thuộ



hi Panax L. ghi nh n



Việt N m



hi Panax L.



i m giải ph u:

i m giải ph u



lo i, thứ lo i thuộ



hi Panax L. ghi nh n



Việt



Nam.

- Đặ



i m giải ph u ph n iệt



lo i thứ ủ



hi Panax L.



(4) Nghiên ứu hỉ thị ph n tử v m i qu n hệ i truy n ủ



Việt N m.

m u thu th p v i



các taxon trong cùng chi Panax L.

- T h hiết ADN tổng s v khuế h ại v ng gen ITS-rDNA và matK.

- Ph n t h v giải tr nh t v ng gen ITS-rDNA và matK.

-X y



ng



y hủng loại ph t sinh v



(5) So s nh ặ



i m h nh th i v x y



nh gi m i qu n hệ i truy n.

ng kh



ph n loại ủ



hi Panax L.



Nam

2.4. Phương ph p nghiên cứu

2.4.1. Phương pháp khảo cứu, kế thừa tài liệu

− Th m khảo t i liệu

 Vị tr ph n loại v

 Nguồn g

 Đặ



n m



th ng tin



ản v :



nh ph p ủ lo i



v v ng ph n



(trên thế gi i v



i m h nh th i v sinh th i ủ lo i



 Gi trị sử ụng ủ lo i

31



Việt N m)



Việt



− Kế thừ



s liệu v ph



ng ph p nghiên ứu:



 Kế thừ s liệu, kết quả từ



i



o,



nghiên ứu



liên qu n



trong v ngo i n

 C



ph



ph



ng ph p nghiên ứu ặ



i m h nh th i, nghiên ứu giải ph u,



ng ph p nghiên ứu sinh họ ph n tử.



2.4.2. Phương pháp điều tra, thu thập mẫu vật

-



Áp ụng ph



ng ph p i u tr th



trong ―C c p ươn p



pn







Nguyễn Ngh



Th n gi i thiệu



ên cứu t ực vật‖ [21] thu th p th ng tin



m u tiêu ản s ng ngo i t nhiên. Sử ụng m y ịnh vị (GPS)

tr thu m u ngo i th

-



Thu th p



-



y) l m tiêu ản, v m u cây t



i phụ



i m h nh th i v giải ph u.



M u nghiên ứu sinh họ ph n tử l

thu



ịnh vị



ị .



m u v t (thu m u ả



vụ nghiên ứu ặ



x



họn l hoặ



ầu mầm th n rễ. M u



ảo quản trong sili gel h ng ẩm m .



2.4.3. Phương pháp nghiên cứu thực vật, giải phẫu

X

-



X



s

hiện

-



ịnh tên kho họ , m tả ặ

ịnh tên kho họ



ằng ph



kh



ph n loại v



ản m tả ủ



v



t i liệu



 Đặ

Ph



ng ph p so s nh h nh th i [21], trên

hi Panax L. trong



ộ th



v t h



liên qu n.



Chụp ảnh hi tiết



soi nổi v th



i m h nh th i:



ộ ph n, sử ụng m y ảnh, m y s n, k nh hi n vi



o huyên ụng.

i m giải ph u:



ng ph p nghiên ứu giải ph u



theo ph



Nguyễn B (1977) [1], Nguyễn Viết Th n (2013) [20] v

 Tiêu ản, ph u thứ



t, nhuộm:



32



ng ph p nghiên ứu ủ

ải iến ho ph h p.



Bộ ph n khảo s t

t ằng



ịnh trên ụng ụ



o l m. Sử ụng ph u thứ



t ng ng;



th n kh sinh v i thiết iện ph h p; l



M uv tt



t ng ng oạn gi



t ng ng g n gi



ên, oạn 1 3 k từ u ng l , l

non, khảo s t trên nhi u l



họn l l



t tr



v một phần phiến l h i



i m hung.



tiếp kh ng qu xử l . Tuy nhiên



ho việ ki m ịnh s u n y, một s m u



ủ th n rễ v



nh tẻ kh ng qu gi hoặ qu



ghi nh n, m tả ặ



i



t vi ph u ầm t y mi rotom v



l um uv t



ng m trong ung ị h C rnoy I trong



huy n s ng ung ị h ảo quản gồm ồn 70o + gly erin tỷ lệ 1:1.



24h s u



 Quy tr nh l m tiêu ản:

(1) C t m u v tẩy nội hất

(2) Nhuộm m u: Nhuộm màu ằng

(3) Khử n



rmin 0.5% và xanh methylene 0.02%



v g n l men



Quan sát tiêu ản vi ph u



i k nh hi n vi



ộ ph ng ại 50, 100, 200,



400 và 1000.

2.4.4. Phương pháp nghiên cứu sinh học phân tử

2.4.4.1. T c c ết ADN tổn số

To n ộ m u l



thu th p tại th



theo tiêu huẩn ủ ph



ị v



ng ph p CTAB (Doyle 1987). Sử ụng Dne sy pl nt mini



kit (Qi gen, Đứ ). Quy tr nh t h hiết

xuất

B



t ng

1.



ng h m l



B



2.



iv



th y ổi so v i khuyến



ng ADN thu



Nghi n ≤100 mg m u l t

nito l ng,



ảo quản trong Sili -gel

o ủ nh sản



nh s u:



i hoặ ≤20 mg m u l kh (1 m2 ) sử ụng



h y sứ.



Thêm 500µl Buffer AP1 n 4µl RN se A. Chuy n to n ộ ung ị h

v o ng 1,5 ml, vortex t



ột i



65oC. Đảo ng



B



3.



Ủ 60 ph t



B



4.



Thêm 150 µl Buffer P3,



B



5.



Khuyến



trộn



u m u.



ng 15 ph t lần trong su t qu tr nh ủ.

ng



u v ủ 5 ph t trên



o l m thêm: Ly t m h n h p trong 5 ph t



33



.

14.000 v ng ph t.



B



6.



Chuy n ị h nổi v o QIAshere



er Mini spin Column (lil



ặt sẵn trong 2 ml olle tion tu e. Ly t m 2 ph t



- có màu)



14.000 v ng ph t.



B



7.



Chuy n phần ị h v o một ng 1.5 ml m i (kh ng



ung ấp).



B



8.



Thêm 1,5 th t h Buffer AW1, trộn



B



9.



Chuy n 650 µl h n h p v o DNe sy Mini spin Column ặt sẵn trong 2



u ằng pipet.



ml collection tube.

B



10. Ly t m 1 ph t



10.000 v ng ph t. B



ị h thu



, sử ụng lại



collection tube.

B



11. Lặp lại



ly t m trên v i phần m u



n lại. B



ị h thu v



olle tion



tube.

B



12. Đặt DNe sy Mini spin Column v o olle tion tu e m i



B



13. Thêm 500 µl Buffer AW2 vào DNeasy Mini spin Column



B



14. Ly t m 1 ph t



10.000 v ng ph t. B



ị h thu



, sử ụng lại



collection tube.

B



15. Thêm 500µl Buffer AW2 vào DNeasy Mini spin Column



B



16. Ly t m 2 ph t



B



17. Chuy n DNe sy Mini spin Column v o ng 1,5 ml m i (kh ng



14.000 v ng ph t



ung ấp).

B



18. Thêm 100 µl Buffer AE. Ủ 20 ph t



nhiệt ộ ph ng. Ly t m 2 ph t



10.000 vòng/phút.

B



19. Lặp lại



B



20. Bảo quản ADN tổng s thu

Đ



nh gi



trên một lần n



hất l



v i 50 µl Buffer AE.

-20˚C.



ng ADN thu



gel g rose 1% v i m rker L m



, h ng t i iện i ADN tổng s trên



DNA Hin III (Thermo Scientific). Đồng th i,



chúng tôi sử ụng m y qu ng phổ NP80 N nophotometer

sạ h ADN ủ m u th ng qu gi trị hấp thụ qu ng



o nồng ộ v



ộ tinh



s ng 260 nm v 280 nm.



2.4.4.2. Khuếch đại đoạn gen ITS-rDNA và matK

Th nh phần v



i u kiện phản ứng PCR nh n ản v ng gen ITS-rDNA và



34



tr nh



matK



y trong ảng 2. Ch ng t i sử ụng 2 × T q PCR M ster Mix



(Thermo S ientifi ) gồm T q DNA polymer se,

trộn sẵn v i tỷ lệ t i u ho hầu hết

Bảng 2.2. Đoạn mồi

Mồi

(Primer)



Locus



Nnc18S10



NTP v



ệm



ph i



phản ứng PCR.

sử ụng ho PCR v giải tr nh t



Trình tự 5’ – 3’



Nguồn



AGGAGAAGTCGTAACAAG



Wen & Zimmer, 1996



GTTTCTTTTCCTCCGCT



Wen & Zimmer, 1996



ITS

C26A

AF



CTATATCCACTTATCTTTCAGGAGT



Ooi et al. 1995



8R



AAAGTTCTAGCACAAGAAAGTCGA



Ooi et al. 1995



matK



Bảng 2.3. Thành phần v



i u kiện phản ứng PCR nhân bản vùng gen ITS-rDNA và

matK



Thành phần

N



khử ion



Thể tích (L)



Chu trình nhiệt



6,5



* Biến t nh ầu: 94°C trong 5’



2 × Taq PCR Master Mix



12,5



Mồi xu i (2,5 M)



4,0



Mồi ng



(2,5 M)



Tổng thể tích

Sản phẩm PCR

hất l



-



Biến tính: 94°C-30‖



-



G n mồi: 50°C-45‖



-



Kéo dài: 72°C-90’’



2,0 (10-50 ng) * Tổng h p cu i: 72°C-10’



ADN khuôn



nh gi



4,0



*Lặp lại 37 hu k :



25,0



* Gi sản phẩm 4°C - 



iện i trên gel g rose 1% v i m rker BM2000



ng ủ qu tr nh PCR.



35



2.4.4.3. Phân tích trình tự ADN trên các vùng gen nghiên cứu

Sản phẩm PCR



nh n



ng th nh



ng sẽ



QIAqui k gel extr tion kit (Qi gen, Đứ ) theo h

vụ ho



ng



tinh sạ h



n ủ nh sản xuất



th nghiệm tiếp theo. Sản phẩm s u khi tinh sạ h



ụng m y ph n t h ph n



oạn ADN t



ằng

phụ



giải tr nh t sử



ộng ABI PRISM 3730 (Applie



Biosystems) và kit BigDye® Terminator v3.1 cycle sequencing (Applied

Biosystems). Kết quả giải tr nh t

qu



x



m



ằng phần m m BioE it version 7.1.9,



ịnh ki u gen ủ từng m u.



Một kết quả giải tr nh t t t ần ảm ảo:

- B n loại nu leotit

(G), m u x nh n



ph n iệt



i nl



i



m u (v



ytosine (C), m u



l thymine (T)). T n hiệu hu nh qu ng ủ

ràng, cá h



l



ụ: m u v ng l gu nine



enine (A) v m u x nh l



nu leotit l



ỉnh m u



y

n, rõ



u nh u.



- Kh ng



hoặ



t n hiệu n n nhiễu thấp.



2.4.4.4. Xây dựng cây phát sinh chủng loại

Sử ụng phần m m Geneious 6.0.6

nu leoti e



n hỉnh ằng ằng



l pr p



hu i nu leoti ,



hu i



h sử ụng phần m m MUSCLE 3.8.31, s u



hỉnh ằng t y trong Geneious. Nh ng ặp liên kết kh ng rõ r ng (nh ng

v ng kh ng m h )

C



loại



tr



ph n t h ph t sinh lo i



lẻ ằng ph



khi x y



ng lại hu i.



tiến h nh v i



v ng tr nh t ADN riêng



ng ph p Maxximum Likehood (ML) trong RaxML 8.2.8 (Stamakis,



2014) và Bayesian (BI) trong MrBayes v.3.2.6 (Ronquist và Huelsenbeck, 2003)

trên CIPRES S ien e G tew y theo m h nh GTR + G v i gi trị ootstr p 1000 lần

lặp lại.

Đ ph n t h m i qu n hệ i truy n v x y

tôi



th m khảo v sử ụng



ng



y qu n hệ ph t sinh, h ng



tr nh t vùng gen ITS-rDNA và matK sẵn



Genbank ủ 46 m u, thuộ 13 taxon,



thu th p tại 6 qu



gi v v ng l nh thổ



gồm M , Trung Qu , Nh t Bản, Nep l, Đ i Lo n v Việt N m (C

lục 1).



36



trên



t ết xem p ụ



Chương 3. KẾT QUẢ NGHIÊN CỨU

3.1. X c định thành phần c c loài/thứ thuộc chi Panax L. ở Việt Nam

Đ x

thuộ



ịnh tên kho họ , nghiên ứu ặ



hi Panax



tiêu ản

v i kh



Việt N m



thu th p



i m h nh th i ủ



lo i thứ



, chúng tôi tiến h nh phân tích 103



l u gi tại các phòng tiêu ản và 70 tiêu ản thu th p

ph n loại, ản m tả



lo i thuộ



79, 83] v tiêu ản m u type ủ



,



i hiếu



hi Panax L. [6, 8, 22, 28, 33, 64, 67,



lo i Panax l u gi tại một s ph ng tiêu ản



trên thế gi i ( hi tiết xem P ụ lục 2).

Trong quá trình ph n t h, ịnh

h ng t i nh n thấy một s



i m



- Lo i T m thất h y

v n



ghi nh n l



nh tiêu ản



ng l u



lo i thứ thuộ



hi Panax,



s u:



n gọi l Giả nh n s m (Panax pseudoginseng Wallich)



y nh p trồng



v ng iên gi i ph B



v C o Bằng [7, 11], một s tiêu ản hiện

NIMM.409(A, B, C, D) thu tại Ph



thuộ tỉnh H Gi ng



n l u gi tại Viện D



C o, H



liệu gồm



Gi ng n m 1963 v



tiêu



ản



NIMM.1931 thu tại Bảo Lạ , C o Bằng n m 1972. Tuy nhiên ến th i i m hiện

tại, s u nhi u



t khảo s t tại C o Bằng, H Gi ng v



n i ph B



kh ng



n



t gặp loài này. Th y v o



thất tại H Gi ng (Đồng V n), L o C i (B

y



ng



T m thất



trồng







i m trồng T m

ịnh



u thuộ lo i P. notoginseng (Burkill) F.H.Chen (T m thất,



hạt h nh ầu-trứng, h i

ặ tr ng



i hạt



nh p trồng từ l u, lo i



3 g v i ạnh ên kh ng ị ép ẹt, t n



80-100 ho , v i nhụy h p t nhất ến phần gi

W lli h



tại



n thuộ mi n



H , Si M C i) h ng t i x



. P. notoginseng (Burkill) F.H.Chen ũng



ặ tr ng



tỉnh l n



trong khi lo i P. pseudoginseng



ạnh ên ép ẹt, t n 20-50 ho , v i nhụy xẻ 2 từ



g .

- Loài Nhân sâm (h y

nh p trồng thử nghiệm

ng, ến n y ũng kh ng



n gọi l S m tri u tiên) – P. ginseng C.A.Mey.



S P , L o C i từ nh ng n m 1990 nh ng h

n l u gi



gi ng. Lo i n y ặ tr ng



37



th nh

i hạt ẹt,



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Chương 2. MỤC TIÊU, ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU

Tải bản đầy đủ ngay(0 tr)

×