Tải bản đầy đủ - 0 (trang)
3 Sequence-Specific Detection of Highly Homologous miRNAs Using RCA Approach

3 Sequence-Specific Detection of Highly Homologous miRNAs Using RCA Approach

Tải bản đầy đủ - 0trang

3 Preparation of Circular Templates by T4 RNA Ligase 2 for Rolling Circle…



31



Fig. 3.4 Histograms showing the ligation efficiencies of various T4 ligases for different duplexes

composed of DNA and/or RNA oligonucleotides hybridized to chimeric DNA-RNA MB, where

the quantities of DNA ligase, RNA ligase 1, and RNA ligase 2 were 3.5, 1, and 1 U, respectively.

(Reproduced with permission from Zhao et al. 2015)



To prove this ability, five padlock probes for five members (let-7a, let-7b, let-7c,

let-7d, and let-7e) were designed, and seven samples were prepared for each padlock probe (Table 3.3). The first five samples contain only one member of let-7

family at the same concentration, the sixth one is a mixture of four members of let-7

family at the same concentration except the target miRNA (termed as mixture 1),

and the last one contains all five members of let-7 family (termed as mixture 2).

The RCA results shown in Fig. 3.5 prove that each padlock probe can accurately

identify the corresponding miRNA target and to notably discriminate it from other

let-7 members. Considering the experimental reality where different miRNA members might exist in samples with different abundances, we then designed experiments to determine the detection limit at which the targeted let-7 member can be

distinguished from the most closely relevant members of let-7 family. For this

purpose, mixtures of miRNAs let-7a and let-7e at the volume ratio of 1:1 at the same

concentration of 50, 5, 2.5, and 1 fmol were prepared, and then probe-7a was used

to detect let-7a on the background of let-7e. As it can be seen in Fig. 3.6, probe-7a

can unambiguously distinguish the target miRNA let7-a from let-7e at concentrations as high as 50 fmol (Fig. 3.6a) and/or as low as 2.5 fmol (Fig. 3.6c).

Note that other studies have reported the 10 fmol limit for RCA detection of

miRNAs (Cheng et al. 2009; Li et al. 2013). The somewhat lower, 2.5 fmol detection

limit found by us can be attributed to the different design/sequence of probes used

for RCA by others (Mao et al. 2015). Also note that with other RCA formats employing T4 RNA ligase 2 and with optimized sequence of padlock probe, even lower

miRNA detection limit could be reached (Liu et al. 2013).



Sequences (5′-3′)

CTACTACCTCATCTTGTTTCCTTTCCTTGAAACTTCTTCCTAACTATACAAC

CTACTACCTCATCTTGTTTCCTTTCCTTGAAACTTCTTCCTAACCACACAAC

CTACTACCTCATCTTGTTTCCTTTCCTTGAAACTTCTTCCTAACCATACAAC

TACTACCTCTTCTTGTTTCCTTTCCTTGAAACTTCTTCCTACTATGCAACC

TCCTACCTCATCTTGTTTCCTTTCCTTGAAACTTCTTCCTACTATACAACC

UGAGGUAGUAGGUUGUAUAGUU

UGAGGUAGUAGGUUGUGUGGUU

UGAGGUAGUAGGUUGUAUGGUU

AGAGGUAGUAGGUUGCAUAGU

UGAGGUAGGAGGUUGUAUAGU



Note: The bold letters are ribonucleotides. The regions of padlocks which hybridize with target miRNAs are underlined. Boxes highlight the nucleotide differences between different miRNAs



Notation

Probe-7a

Probe-7b

Probe-7c

Probe-7d

Probe-7e

Let-7a

Let-7b

Let-7c

Let-7d

Let-7e



Table 3.3 Nucleotide sequences of miRNA let-7 family members and padlock probes used to identify each target miRNA member



32

Y. Guan et al.



3 Preparation of Circular Templates by T4 RNA Ligase 2 for Rolling Circle…



33



Fig. 3.5 Histograms showing the detection specificity of the each padlock probe to identify the

target let-7 members. Mixture 1 contains four let-7 members excluding the intended target let-7

miRNA, whereas mixture 2 contains all five let-7 family members, the concentration of each member is 2.5 fmol. (Reproduced with permission from Zhao et al. 2015)



4



Summary and Outlook



This study proves the superior performance of T4 RNA ligase 2 over other ligases in

preparation of circular templates for RCA detection of target miRNAs with high specificity and sensitivity. Resulting data showed that miRNA family members, even being

different from each other by only one nucleotide, could be selectively identified in the



34



Y. Guan et al.



Fig. 3.6 Fluorescence curves showing the discrimination limit of Probe-7a to differentiate let-7a

(solid square) and let-7e (blank square) at the concentration of 50 (a), 5 (b), 2.5 (c), and 1.0 fmol

(d). (e) Histogram representation of results a–d for convenient visualization: each bar represents

fluorescence intensities taken at 2200 s. (Reproduced with permission from Zhao et al. 2015)



presence of other homologous miRNAs at femtomolar concentrations. Given the significant potential of miRNAs as novel biomarkers for disease diagnosis and prognosis,

these results are important for the development of new clinical diagnostics.

Acknowledgment This work was supported by grants from the National Natural Science

Foundation of China (No. 81371896 and No. 81301517).



3 Preparation of Circular Templates by T4 RNA Ligase 2 for Rolling Circle…



35



References

Allison S, Cheng C, Stigter D (2001) The length dependence of translational diffusion, free solution electrophoretic mobility, and electrophoretic tether force of rigid rod-like model duplex

DNA. Biophys J 81(5):2558–2568

Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136(2):215–233

Bullard DR, Bowater RP (2006) Direct comparison of nick-joining activity of the nucleic acid

ligases from bacteriophage T4. Biochem J 398(1):135–144

Calin GA, Croce CM (2006) MicroRNA signatures in human cancers. Nat Rev Cancer 6(11):857–866

Chen C, Ridzon DA et al (2005) Real-time quantification of microRNAs by stem-loop

RT-PCR. Nucleic Acids Res 33(20):e179

Cheng Y, Zhang X, Li Z et al (2009) Highly sensitive determination of microRNA using targetprimed and branched rolling-circle amplification. Angew Chem Int Ed Engl 48(18):3268–3272

Dalmay T, Edwards DR (2006) MicroRNAs and the hallmarks of cancer. Oncogene

25(46):6170–6175

Fiedler SD, Carletti MZ, Christenson LK (2010) Quantitative RT-PCR methods for mature

microRNA expression analysis. Methods Mol Biol 630:49–64

Fu HJ, Zhu J, Yang M et al (2006) A novel method to monitor the expression of microRNAs. Mol

Biotechnol 32(3):197–204

Hagerman PJ (1988) Flexibility of DNA. Annu Rev Biophys Biophys Chem 17:265–286

Jonstrup SP, Koch J, Kjems J (2006) A microRNA detection system based on padlock probes and

rolling circle amplification. RNA 12(9):1747–1752

Kroh EM, Parkin RK, Mitchell PS, Tewari M (2010) Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods

50(4):298–301

Kuhn H, Protozanova E, Demidov VV (2002) Monitoring of single nicks in duplex DNA by gel

electrophoretic mobility-shift assay. Electrophoresis 23(15):2384–2387

Lee H, Han S, Kwon SC et al (2015) Biogenesis and regulation of the let-7 miRNAs and their

functional implications. Protein Cell 7(2):100–113

Li Y, Liang L, Zhang CY (2013) Isothermally sensitive detection of serum circulating miRNAs for

lung cancer diagnosis. Anal Chem 85(23):11174–11179

Liu H, Li L, Duan L et al (2013) High specific and ultrasensitive isothermal detection of microRNA

by padlock probe-based exponential rolling circle amplification. Anal Chem 85(16):7941–7947

Liu L, Tang Z, Wang K et al (2005) Using molecular beacon to monitor activity of E. coli DNA

ligase. Analyst 130(3):350–357

Liu N, Okamura K, Tyler DM et al (2008) The evolution and functional diversification of animal

microRNA genes. Cell Res 18(10):985–996

Mao Y, Liu M, Tram K et al (2015) Optimal DNA templates for rolling circle amplification

revealed by in vitro selection. Chemistry 21(22):8069–8074

Nelson PT, Baldwin DA, Scearce LM et al (2004) Microarray-based, high-throughput gene expression profiling of microRNAs. Nat Methods 1(2):155–161

Paul S, Datta SK, Datta K (2015) miRNA regulation of nutrient homeostasis in plants. Front Plant

Sci 6:232

Roush S, Slack FJ (2008) The let-7 family of microRNAs. Trends Cell Biol 18(10):505–516

Zhao B, Song J, Guan Y (2015) Discriminative identification of miRNA let-7 family members with

high specificity and sensitivity using rolling circle amplification. Acta Biochim Biophys Sin

47(2):130–136



Chapter 4



Use of DNA CircLigase for Direct Isothermal

Detection of Microbial mRNAs by RNAPrimed Rolling Circle Amplification

and Preparation of ø29 DNA Polymerase Not

Contaminated by Amplifiable DNA

Hirokazu Takahashi, Yoshiko Okamura, and Toshiro Kobori



1



Introduction



Presently, conventional microbial detection methods employ either microbial

cultivation in selective media that requires several days, or detection of specific

microbial RNAs by reverse transcription PCR (RT-PCR), which is more rapid, but

still suffer from certain disadvantages, such as false-positive contamination problems and the need in costly thermocycling equipment. Recently, the workability of

isothermal detection of micro-RNAs (miRNAs) and messenger RNAs (mRNAs) by

rolling circle amplification (RCA) using ø29 DNA polymerase, circular probes, and

RNA as a primer for DNA synthesis (Jonstrup et al. 2006; Lagunavicius et al. 2008,



H. Takahashi, Ph.D. (*)

NanoBiotetchnology Laboratory, Food Engineering Division, National Food Research

Institute, National Agriculture and Food Research Organization, Tsukuba, Ibaraki, Japan

CREST, Japan Science and Technology Agency, Higashihiroshima, Hiroshima, Japan

Department of Molecular Biotechnology, Graduate School of Advanced

Sciences of Matter, Hiroshima University, Higashihiroshima, Hiroshima, Japan

e-mail: ziphiro@hiroshima-u.ac.jp

Y. Okamura

CREST, Japan Science and Technology Agency, Higashihiroshima, Hiroshima, Japan

Department of Molecular Biotechnology, Graduate School of Advanced

Sciences of Matter, Hiroshima University, Higashihiroshima, Hiroshima, Japan

T. Kobori (*)

NanoBiotetcnology Laboratory, Food Engineering Division, National Food Research

Institute, National Agriculture and Food Research Organization, Tsukuba, Ibaraki, Japan

e-mail: tkobo@affrc.go.jp

© Springer International Publishing Switzerland 2016

V.V. Demidov (ed.), Rolling Circle Amplification (RCA),

DOI 10.1007/978-3-319-42226-8_4



37



38



H. Takahashi et al.



2009) was demonstrated, which enables RNA-primed RCA (RP-RCA) to amplify

DNA from RNA primer without reverse-transcription.

Importantly, we expect that RCA is more resistant to carry-over contamination of

the amplification products than PCR because RCA does not generate a new 3′-end

ssDNA during DNA synthesis, which is a potential primer for non-specific DNA

synthesis (Takahashi et al. 2010; Kobori and Takahashi 2014). All this suggests that

RP-RCA using ø29 DNA polymerase could be more easily and more reliably applied

to field tests and point-of-care testing (POCT) than RT-PCR (Takahashi et al. 2010),

therefore making RP-RCA the method of choice for detecting microbial mRNAs as

a signature of viable pathogens (Norton and Batt 1999; Keer and Birch 2003).

To prepare circular probe for RP-RCA, linear DNA oligonucleotide can be circularized by T4 DNA ligase when bound to RNA target (padlock probes; Jonstrup

et al. 2006) or with the use of so-called “splint” or “bridge” oligonucleotide

(Lagunavicius et al. 2008, 2009). However, the efficiency of ligation/circularization

of DNA padlocks with T4 DNA ligase on RNA targets is rather low (Li et al. 2009,

also see Chap. 2), whereas the use of “splints” is often the cause of non-specific

DNA synthesis, which interferes with the specificity of RCA reaction (Kobori et al.

2009; Murakami et al. 2009).

CircLigase™ ssDNA ligase (Epicentre, Madison, WI, USA) effectively catalyzes the circularization of single-stranded DNA and RNA by intramolecular ligation of a phosphate at the 5′ end and a hydroxyl group at the 3′ end without the use

of “splint” oligonucleotide (Fig. 4.1a). Thus, employment of CircLigase could

reduce non-specific DNA synthesis (source of false-positive signals in real-time

detection formats) intrinsic in splinted ligation (Kobori et al. 2009; Murakami et al.

2009; Takahashi et al. 2010).



Fig. 4.1 (a) Schematics of preparation of circular probes used in this study. The probe’s region

hybridized to target mRNA is marked blue. (b) Schematics of microbial mRNA detection using

RP-RCA. The part of mRNA complementary to circular probe is marked red



4



Use of DNA CircLigase for Direct Isothermal Detection of Microbial mRNAs…



39



Assay developed by us for microbial mRNA detection by RP-RCA comprises

the steps shown schematically in Fig. 4.1b. In the following sections, we show

experimental details of RP-RCA detection of model mRNA transcript expressed in

E. coli by using circular DNA probe prepared by CircLigase and amplified by the

ø29 DNA polymerase.



2

2.1



Materials Necessary for RP-RCA

CircLigase ssDNA LigasessDNA Ligase



CircLigase used by us (sometime referred as CircLigase I) is a thermostable enzyme

that requires ATP as an essential reaction component for its activity. One more similar enzyme, CircLigase II, which does not require ATP for its activity, is also commercially available from Epicentre, and it can also be used for ATP-free probe

circularization (see Chap. 11 in the ‘therapeutic’ section of this book). The choice

between two CircLigases can be done experimentally based on their efficiency for

circularization of particular DNA probe as there was a report that CircLigase may

yield much higher circularization efficiency compared to CircLigase II (Heyer et al.

2015; also see Note 1 below).



2.2



Oligonucleotides for Circular Probe Preparation



Phosphorilation of 5′ end of an oligonucleotide is necessary for its circularization

by CircLigases. According to our studies (Takahashi et al. 2010), 50–60-nt-long

oligonucleotides are quite optimal for preparation of circular probes in terms of cost

and efficiency. Though longer probes can be circularized somewhat more efficiently,

they are more costly and may also cause the mismatched hybridization to non-target

RNA molecules, so that nonspecific amplification was often observed in our preliminary experiments with longer probes. Shorter probes in our experience may not

be effective in RP-RCA (Takahashi et al. 2010). Also in our experience, and in

accord with data by Nunez et al. (2008), oligonucleotide probes having 5′G and 3′T

as terminal nucleotides tend to enhance the ligation efficiency.



2.3



Exonuclease for Circular DNA Purification



After circularization of ssDNA probe, the linear ssDNA remaining in the ligation

mixture must be degraded by treatment with Exonuclease I (New England BioLabs,

Ipswich, MA, USA) to prevent non-specific DNA synthesis in the RP-RCA reaction

(Kobori et al. 2009; Takahashi et al. 2010). Then, exonuclease-treated circular



40



H. Takahashi et al.



oligonucleotides should be purified using, e.g., BioSpin-30 micro-columns (BioRad,

Hercules, CA, USA) or High Pure PCR cleanup Micro kit (Roche Diagnostics

GmbH, Mannheim, Germany).



2.4



ø29 DNA Polymerase



ø29 DNA polymerase has an optimum temperature for maximal activity between

25 and 42 °C, and it has strong strand-displacement activity and high DNA processivity (Blanco et al. 1989). In addition, ø29 DNA polymerase can use RNA as a

primer for DNA synthesis (Jonstrup et al. 2006). Thus, ø29 DNA polymerase is the

enzyme of choice for RP-RCA reaction and would be helpful specifically for field

tests and point-of-care testing (POCT), which should be usually done at nearly

room temperature.

Mg2+ cations are necessary for polymerase activity, but they are easily chelated

by pyrophosphate (PPi) produced as a byproduct of DNA synthesis by ø29 DNA

polymerase so that the concentration of Mg2+ could drop significantly during

extended RP-RCA reaction. Therefore, addition of inorganic pyrophosphatase to

the reaction mixture may enhance RP-RCA efficiency.

It is also known that addition of ~20–40 mM (NH4)2SO4 and ~0.03 % Tween 20,

or a combination of both, to the reaction buffer highly improves the RCA amplification with ø29 DNA polymerase (Salas Falgueras et al. 2013) and may also prevent

non-specific DNA amplification (Blanco et al. 1989). To our knowledge, some companies supply ø29 DNA polymerase reaction buffers without (NH4)2SO4, and therefore, it should be noted that (NH4)2SO4 concentration in a reaction buffer is

appropriately adjusted so as to be ~20–40 mM at a final concentration. This chapter

presents results obtained using RepliPhi ø29 DNA polymerase (Epicentre) in combination with the house-made reaction buffer 50 mM Tris–HCl (pH 7.5), 10 mM

MgCl2, 20 mM (NH4)2SO4, and 10 mM KCl (see Note 2).

Besides, commercially available ø29 DNA polymerases are obtained from

recombinant E. coli cells, and these enzymes are possibly contaminated with host

DNA and expression plasmids even after purification, since the polymerase has a

high affinity for both ssDNA and dsDNA by its nature. Therefore, non-specific

DNA synthesis, which is called ‘noise’ hereafter, is sometimes occurred in the

amplified products, especially when low copy numbers of target nucleic acid is

employed in amplification reactions (see Note 3). Though a mechanism of ‘noise’ is

unclear, it is certainly caused by not only contaminating dsDNA but also

contaminating ssDNA in the RCA reaction mixture (Kobori et al. 2009; Murakami

et al. 2009; Takahashi et al. 2010). Through our experience, we learned that the

amount of free 3′-end in contaminating DNA contributed mostly in the ‘noise’

intensity; however, the critical threshold level of contamination has not been defined.

In case this happens, we recommend to use the DNA-free ø29 DNA polymerase

recently developed by us (Takahashi et al. 2014). We designed an effective procedure for decontaminating this enzyme from both ssDNAs and dsDNAs during



4



Use of DNA CircLigase for Direct Isothermal Detection of Microbial mRNAs…



41



purification of ø29 DNA polymerase obtained from recombinant E. coli cells. Our

strategy consists of three steps: (a) host DNA was immediately removed from cell

lysate containing the DNA polymerase; (b) the rest contaminating dsDNAs were

inactivated by photo-crosslinking using ethidium monoazide and light-emitting

diode; (c) the remaining ssDNAs were degraded by 3′–5′ exonuclease activity of

the polymerase itself. Thus, the DNA-free ø29 DNA polymerase made by our strategy does not include any amplifiable DNA (Takahashi et al. 2014). It is now available on the market as a research material from Kanto Chemical (Tokyo, Japan).



2.5

1.

2.

3.

4.

5.

6.

7.

8.



Additional Laboratory Reagents



RNase AWAY (Molecular BioProducts; see Note 4)

UltraPure™ DNase/RNase-Free Distilled water (Invitrogen, Carlsbad, CA, USA)

High Pure PCR cleanup Micro kit (Roche)

Quant-iT™ RNA BR assay kit (now named Qubit® RNA BR Assay Kit,

Invitrogen)

Quant-iT™ ssDNA Assay Kit (now named Qubit+ ssDNA Assay Kit, Invitrogen)

SYBR Green II stain, 10,000ì concentrate in DMSO (Invitrogen)

Trizolđ Max Bacterial RNA Isolation kit (Invitrogen)

Overnight Express™ Autoinduction System (Novagen, Darmstadt, Germany)



3

3.1



Methods

Preparation of RNA Sample from iRecombinant E. coli



To prepare total RNA containing GFP mRNA (the model analyte mRNA to be

detected by RP-RCA), the E. coli strain BL21 (DE3) was transformed with pETAcGFP plasmid comprising IPTG-inducible T7 expression vector pET-21d with

selectable marker gene ampR (Novagen) and GFP-coding gene from pAcGFP1

(Clontech, Mountain View, CA, USA). Ampicillin-resistant clones were grown for

GFP expression, which was confirmed by the GFP-characteristic fluorescence of

selected transformant induced in Overnight Express Autoinduction System

(Novagen) and irradiated with blue light (Fig. 4.2).

Total RNA from induced E. coli transformants were isolated using the Trizol®

Max Bacterial RNA Isolation kit and RNA concentrations in test samples were

determined in fluorometer using Quant-iT™ RNA BR assay kit. RNA samples were

analyzed by agarose gel electrophoresis to confirm that they contain, besides GFP

mRNA, significant amount of non-target RNAs, such as, 5S, 16S, 23S rRNAs, etc.

(data not shown). Importantly, the RNA samples were not treated with DNase I,

although such additional treatment is essential for RT-PCR.



42



H. Takahashi et al.



Fig. 4.2 GFP expression

in E. coli cells transformed

with pET–AcGFP plasmid.

Green fluorescence of cells

irradiated by blue light

proves that GFP is

produced in the induced

transformants, but not in

the non-induced ones



3.2



DNA Probe Circularization



All necessary oligonucleotides (Fig. 4.4) were purchased from Hokkaido System

Science (Sapporo, Japan) and were phosphorylated using 10 U of T4 polynucleotide kinase (New England BioLabs) in 1× T4 ligase buffer (New England BioLabs)

containing 1 mM ATP and incubated at 37 °C for 1 h. Phosphorylated oligonucleotides were circularized using 100 U of CircLigase™ ssDNA Ligase at 65 °C for

1 h in 1× CircLigase reaction buffer containing 2.5 mM MnCl2 and 1 mM ATP

according to the manufacturer’s protocol.

Uncircularized oligonucleotides were degraded by adding 10 U of exonuclease I

and incubated at 37 °C for 1 h, followed by enzyme inactivation at 80 °C for 20 min.

Then, exonuclease-treated oligonucleotides were purified using High Pure PCR

cleanup Micro kit (see Note 2).

The concentrations of circular probes were determined in fluorometer using a

Quant-iT™ ssDNA Assay Kit. The quality of circular probes was routinely checked

by electrophoresis in agarose gel electrophoresis stained with UltraPower DNA/

RNA Safedye (Fig. 4.3).



3.3



Real-Time RP-RCA Reaction



Total RNA isolated from induced E. coli transformants was mixed with 10 pmol of

circular probe, P1 or P5 (see Table 4.1), in 100 μL of the house-made reaction buffer

(see Sect. 2.4 above). Hybridization of mRNA with circular probe was performed by

incubation of this mixture at 95 °C for 5 min followed by immediate cooling to

30 °C. The RCA reaction was initiated by mixing 100 μL of the hybridized mixture

with 100 μL of a reaction buffer containing 0.4 mM deoxynucleoside triphosphate

(dNTPs)), 8 mM dithiothreitol (DTT), 2× SYBR Green II, and 100 U of ø29 DNA

polymerase. Fluorescence of SYBR Green II upon binding to ssDNA synthesized by

ø29 DNA polymerase was routinely assayed in fluorometer every 15 min (Fig. 4.4).



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

3 Sequence-Specific Detection of Highly Homologous miRNAs Using RCA Approach

Tải bản đầy đủ ngay(0 tr)

×