Tải bản đầy đủ - 0 (trang)
6 Measurement of the Accuracy of the Fusion DNA Polymerases

6 Measurement of the Accuracy of the Fusion DNA Polymerases

Tải bản đầy đủ - 0trang

2 Improvement of ϕ29 DNA Polymerase Amplification Performance by Fusion of DNA…



23



Acknowledgements This work has been aided by research grants from the Spanish Ministry of

Economy and Competitiveness [BFU2014-53791-P to M.V.] and [BFU2014-52656-P to M.S.] and

by an institutional grant from Fundación Ramón Areces to the Centro de Biología Molecular

Severo Ochoa.



References

Berman AJ, Kamtekar S, Goodman JL, Lázaro JM, de Vega M, Blanco L, Salas M, Steitz TA

(2007) Structures of phi29 DNA polymerase complexed with substrate: the mechanism of

translocation in B-family polymerases. EMBO J 26:3494–3505

Bernad A, Zaballos A, Salas M, Blanco L (1987) Structural and functional relationships between

prokaryotic and eukaryotic DNA polymerases. EMBO J 6:4219–4225

Blanco L, Salas M (1985) Characterization of a 3′-5′ exonuclease activity in the phage ϕ29encoded DNA polymerase. Nucleic Acids Res 13:1239–1249

Blanco L, Salas M (1996) Relating structure to function in ϕ29 DNA polymerase. J Biol Chem

271:8509–8512

Blanco L, Bernad A, Lázaro JM, Martín G, Garmendia C, Salas M (1989) Highly efficient DNA

synthesis by the phage ϕ29 DNA polymerase. Symmetrical mode of DNA replication. J Biol

Chem 264:8935–8940

Blasco MA, Blanco L, Parés E, Salas M, Bernad A (1990) Structural and functional analysis of

temperature-sensitive mutants of the phage ϕ29 DNA polymerase. Nucleic Acids Res

18:4763–4770

Davidson JF, Fox R, Harris DD, Lyons-Abbott S, Loeb LA (2003) Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase. Nucleic Acids Res 31:4702–4709

de Vega M, Blanco L, Salas M (1999) Processive proofreading and the spatial relationship between

polymerase and exonuclease active sites of bacteriophage ϕ29 DNA polymerase. J Mol Biol

292:39–51

de Vega M, Lazaro JM, Mencia M, Blanco L, Salas M (2010) Improvement of ϕ29 DNA polymerase amplification performance by fusion of DNA binding motifs. Proc Natl Acad Sci U S

A 107:16506–16511

Dean FB, Nelson JR, Giesler TL, Lasken RS (2001) Rapid amplification of plasmid and phage

DNA using Phi29 DNA polymerase and multiply-primed rolling circle amplification. Genome

Res 11:1095–1099

Dean FB, Hosono S, Fang L, Wu X, Faruqi AF, Bray-Ward P, Sun Z, Zong Q, Du Y, Du J et al (2002)

Comprehensive human genome amplification using multiple displacement amplification. Proc

Natl Acad Sci U S A 99:5261–5266

Demidov VV, Broude NE (2004) Preface. In: Demidov VV, Broude NE (eds) DNA amplification.

Current technologies and applications. Horizon Bioscience, Wymondham, pp ix–x

Dufour E, Méndez J, Lázaro JM, de Vega M, Blanco L, Salas M (2000) An aspartic acid residue in

TPR-1, a specific region of protein-priming DNA polymerases, is required for the functional

interaction with primer terminal protein. J Mol Biol 304:289–300

Esteban JA, Salas M, Blanco L (1993) Fidelity of ϕ29 DNA polymerase. Comparison between

protein-primed initiation and DNA polymerization. J Biol Chem 268:2719–2726

Esteban JA, Soengas MS, Salas M, Blanco L (1994) 3′-5′ exonuclease active site of ϕ29 DNA

polymerase. Evidence favoring a metal ion-assisted reaction mechanism. J Biol Chem 269:

31946–31954

Garmendia C, Bernad A, Esteban JA, Blanco L, Salas M (1992) The bacteriophage ϕ29 DNA

polymerase, a proofreading enzyme. J Biol Chem 267:2594–2599

Ibarra B, Chemla YR, Plyasunov S, Smith SB, Lazaro JM, Salas M, Bustamante C (2009)

Proofreading dynamics of a processive DNA polymerase. EMBO J 28:2794–2802



24



M. de Vega et al.



Johne R, Müller H, Rector A, van Ranst M, Stevens H (2009) Rolling-circle amplification of viral

DNA genomes using phi29 polymerase. Trends Microbiol 17:205–211

Kamtekar S, Berman AJ, Wang J, Lázaro JM, de Vega M, Blanco L, Salas M, Steitz TA (2004)

Insights into strand displacement and processivity from the crystal structure of the proteinprimed DNA polymerase of bacteriophage ϕ29. Mol Cell 16:609–618

Kornberg A, Baker TA (1992) DNA replication, 2nd edn. W.H. Freeman, New York

Lázaro JM, Blanco L, Salas M (1995) The purification of bacteriophage ø29 DNA polymerase.

Methods Enzymol 262:42–49

López-Bueno A, Tamames J, Velázquez D, Moya A, Quesada A, Alcamí A (2009) High diversity

of the viral community from an Antarctic lake. Science 326:858–861

Maruyama F, Nozawa T, Aikawa C, Sakurai A, Nakagawa I (2009) Cost effective DNA sequencing

and template preparation from bacterial colonies and plasmids. J Biosci Bioeng 107:471–473

Méndez J, Blanco L, Lázaro JM, Salas M (1994) Primer-terminus stabilization at the ϕ29 DNA

polymerase active site. Mutational analysis of conserved motif Tx2GR. J Biol Chem

269:30030–30038

Mullis KB, Faloona FA (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed

chain reaction. Methods Enzymol 155:335–350

Pavlov AR, Belova GI, Kozyavkin SA, Slesarev AI (2002) Helix-hairpin-helix motifs confer salt

resistance and processivity on chimeric DNA polymerases. Proc Natl Acad Sci U S A

99:13510–13515

Pavlov AR, Pavlova NV, Kozyavkin SA, Slesarev AI (2012) Cooperation between catalytic and

DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases. Biochemistry 51:2032–2043

Qi X, Bakht S, Devos KM, Gale MD, Osbourn A (2001) L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs). Nucleic

Acids Res 29:E116

Rodríguez I, Lázaro JM, Blanco L, Kamtekar S, Berman AJ, Wang J, Steitz TA, Salas M, de

Vega M (2005) A specific subdomain in ϕ29 DNA polymerase confers both processivity and

strand-displacement capacity. Proc Natl Acad Sci U S A 102:6407–6412

Salas M, de Vega M, Lázarto JM, Blanco L, Mencía M (2013) Phage phi29 DNA polymerase

chimera. US patent no 8,404,808 B2. Filed July 2010 and published online on March 26, 2013

Sun S, Geng L, Shamoo Y (2006) Structure and enzymatic properties of a chimeric bacteriophage

RB69 DNA polymerase and single-stranded DNA binding protein with increased processivity.

Proteins 65:231–238

Tabor S, Richardson CC (1985) A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci U S A 82:1074–1078

Takahashi H, Yamazaki H, Akanuma S, Kanahara H, Saito T, Chimuro T, Kobayashi T, Ohtani T,

Yamamoto K, Sugiyama S et al (2014) Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose. PLoS One 9:e82624

Xu Y, Gao S, Bruno JF, Luft BJ, Dunn JJ (2008) Rapid detection and identification of a pathogen’s

DNA using Phi29 DNA polymerase. Biochem Biophys Res Commun 375:522–525



Chapter 3



Preparation of Circular Templates by T4 RNA

Ligase 2 for Rolling Circle Amplification

of Target microRNAs with High Specificity

and Sensitivity

Yifu Guan, Bin Zhao, Guojie Zhao, Chidong Xu, and Hong Shang



1



Introduction



Micro RNAs (miRNAs) are the abundant class of short single-stranded non-coding

RNA molecules of 18–25 nucleotides long, which functions in RNA silencing and

post-transcriptional regulation of gene expression (Bartel 2009). Nowadays, over

2000 miRNAs have been discovered from different species including humans,

plants, and animals (Liu et al. 2008; Paul et al. 2015). Considering the fact that they

are relatively stable in bodily fluids, miRNAs provide a significant potential as

novel biomarkers, for early disease diagnosis as well as for convenient assessment

of disease prognosis (Dalmay and Edwards 2006; Calin and Croce 2006).

To this end, reliable and accurate analysis of specific miRNAs is highly desired.

The most commonly used methods for miRNA analysis, microarrays and RT-qPCR,

have their own limitations. The drawbacks of microarray profiling are the requirement of a large quantity of miRNA sample, low dynamic range, and low detection



Y. Guan, Ph.D. (*) • G. Zhao

Department of Biochemistry and Molecular Biology, China Medical University,

#77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122, China

e-mail: yfguan@cmu.edu.cn

B. Zhao

Key Laboratory of National Sport Bureau, Department of Human Movement Sciences,

Shenyang Sport University, Shenyang 110122, China

C. Xu

Center of Medical Physics and Technology, Hefei Institutes of Physical Science, CAS,

Hefei, Anhui 230031, China

H. Shang (*)

Key Laboratory of AIDS Immunology of National Health and Family Planning Commission,

Department of Laboratory Medicine, The First Affiliated Hospital, China Medical University,

Shenyang, Liaoning 110001, China

© Springer International Publishing Switzerland 2016

V.V. Demidov (ed.), Rolling Circle Amplification (RCA),

DOI 10.1007/978-3-319-42226-8_3



25



26



Y. Guan et al.



Fig. 3.1 (a) Scheme showing the RCA process for miRNA detection. DNA padlock probe hybridizes with the target miRNA and then becomes circularized by ligase. The target miRNA will next be

employed as a primer by phi29 DNA polymerase to be extended via RCA to a long single-stranded

DNA chain. The added SYBR Green II dye binds this long DNA chain and becomes brightly fluorescent. (b) Scheme showing the molecular beacon (MB) assay, which mimics initial steps of the

rolling circle amplification (RCA)-based miRNA analysis and is therefore used for evaluation of the

ligation efficiency of different ligases. The ‘loop’ region in chimeric DNA-RNA MB is composed

of 20 ribonucleotides, with the 8-bp ‘stem’ being formed by hybridization of the two deoxyribonucleotide ‘arms’. [Similar design was used for prior validation of this assay except that all-DNA MB

was employed] After binding to the ‘loop’ of two 10-nt-long deoxy-ribooligonucleotides, R-ON and

L-ON (Table 3.1), MB still remains in the ‘closed’, non-fluorescent state since nick between them

is acting as a ‘hinge’ (Kuhn et al. 2002). After the nick is sealed by ligase, the 20-bp duplex is

formed, which has a straight rod-like shape due to the strong rigidity of short (<100-bp) nucleic acid

duplexes (Hagerman 1988; Allison et al. 2001). As a result, MB will open to become brightly

fluorescent



sensitivity (Nelson et al. 2004). The PCR-based methods require specific primer

design and also suffer from the expensive cost related to labor and instrumentation

(Fiedler et al. 2010; Chen et al. 2005; Kroh et al. 2010; Fu et al. 2006).

Here, we present a robust isothermal method for miRNA analysis based on the

miRNA-driven rolling circle amplification (RCA) with padlock probes (Fig. 3.1a).

The application of padlock probes for miRNA detection relies on the use of either

T4 DNA ligase (Jonstrup et al. 2006) or T4 RNA ligase 2 (Cheng et al. 2009), the

latter providing with better sensitivity. In this study, we validated the superior ligation efficiency of T4 RNA ligase 2 using molecular beacon-based assay and then

evaluated the ability of padlock probes designed by us to identify and discriminate

a particular miRNA from other closely related miRNA species at femtomolar

concentrations.



3 Preparation of Circular Templates by T4 RNA Ligase 2 for Rolling Circle…



2

2.1



27



Materials and Methods

Reagents



Oligonucleotides (including molecular beacon, miRNAs, and padlock probe) at

HPLC purity were purchased from Takara Co., Ltd.. (Dalian, China). All ligases

(T4 DNA ligase, T4 RNA ligase 1, and T4 RNA ligase 2) and phi29 polymerase

were obtained from New England Biolabs (Ipswich, MA, USA). dNTPs were purchased from Sangong (Shanghai, China). Single-strand DNA-specific dye SYBR

Green II was purchased from Promega (Madison, WI, USA). All solutions were

prepared in de-ionized water.



2.2



Molecular Beacon Assay for Ligation Efficiency Analysis



FRET (fluorescence resonance energy transfer)-based molecular beacon (MB)

assay was used to evaluate the ligation efficiency of DNA and RNA ligases.

Nucleotide sequences of all-DNA MB and related oligonucleotides used in validation of molecular beacon assay for assessing ligation reactions are given in Table 3.1.

Fluorophore FITC and quencher DABCYL were tagged to the 3′- and 5′-ends of

MB, respectively. Fluorescence spectra were recorded on Microplate Reader

(Infinite M200, Tecan, USA) with the excitation wavelength at 480 nm, and the time

course of fluorescence changes was recorded at 518 nm emission wavelength.

Equal volumes (0.5 μL) of MB, L-ON, and R-ON at 10 μM concentration were

mixed in 98.5 μL ligation buffer at 37 °C, and fluorescent response recording started.

Once the fluorescence intensity became steady, 3.5 U of ligase was added into the

solution. The fluorescence spectra were then recorded with a 20 s interval and 1 nm

wavelength increment for 100 scales.

Table 3.1 Oligonucleotides

used for valuation of

molecular beacon assay



Notation

DNA MB

L-ON

R-ON

C-ON

L′-ON



Sequences

3′-F-AATACACACTCTGCTGTGATGT

CTCATCTGTGTATT-Q-5′

GAGACGACAC

TACAGAGTAG

GAGACGACACTACAGAGTAG

*GAGACGACAC



Note: All sequences are of DNA nucleotides and they are written 5′ to 3′ with the phosphate group being present at 5′ end,

except that sequence of DNA MB is written from 3′-end to

5′-end for its convenient comparison with the complementary

oligonucleotides and * indicates the absence of 5′-phosphate

group in L′-ON. The loop region of MB is underlined



28



Y. Guan et al.



Table 3.2 Oligonucleotides used for evaluation of ligation efficiency of different T4 ligases

Notation

DNA-RNA

MB

L-DNA

L-RNA

R-DNA

R-RNA



Sequences

3′-F-AATACACACUCUGCUGUGAUGUCUCAUCTGTGTATT-Q-5′

GAGACGACAC

GAGACGACAC

TACAGAGTAG

UACAGAGUAG



Note: The loop region of MB is underlined. Bold letters are ribonucleotides, whereas plain letters

are deoxyribonucleotides. All sequences are written 5′ to 3′ with the phosphate group being present at 5′ end; the sequence of MB is written from 3′-end to 5′-end for convenience



The initial ligation velocity V0 was determined from the slope of the relative fluorescence intensity ΔFI with respect to the reaction time at the start of recording. ΔFI

was calculated using equation ΔFI = (Ft − F0), where F0 was the initial fluorescence

intensity when the ligase was added. V0 was normalized with respect to the ligation

velocity of the mixture (MB + L-ON + R-ON).

Chimeric DNA-RNA MB and ribo- and deoxiribo-oligonucleotides used for

evaluation of ligation efficiency of various T4 ligases are given in Table 3.2.

Protocols for ligation reactions used in these experiments were similar to those

described above.



2.3



Rolling Circle Amplification for miRNA Analysis



Five all-DNA padlock probes specific for let-7 family (let-7a–let-7e) have been

designed, and corresponding let-7 targets have been synthesized. Equal volume of

0.5 μL target miRNA (1 μM) and padlock probe (1 μM) were incubated in ligation

buffer (50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 1 mM DTT, and 400 μM ATP) at

37 °C for 10 min. T4 RNA ligase 2 was added and the circularization of padlock

probes remained for 30 min. The circularized padlock probe solution (1 μL) was

transferred into the mixture solution of 93 μL RCA reaction buffer, 5 μL dNTP, and

1 μL SYBR green II. Fluorescence intensity was monitored for 10 min at 37 °C to

obtain a stable background baseline. 10 U of phi29 DNA polymerase was then added

into this mixture and fluorescence intensity was immediately monitored over time.



3

3.1



Results and Discussion

Validation of Molecular Beacon Assay for Assessing

Ligation Reactions



Schematics in Fig. 3.1b show the principle of the molecular beacon (MB) assay for

assessing the ligation efficiency (Liu et al. 2005). Figure 3.2 proves that ligation of

L-ON and R-ON by T4 DNA ligase, when these 10-nt-long deoxyribo-oligonucleotides



3 Preparation of Circular Templates by T4 RNA Ligase 2 for Rolling Circle…



29



Fig. 3.2 Fluorescence spectra of all-DNA-composed MB hybridized with different deoxyribooligonucleotides. Curve a, MB alone; curve b, MB hybridized with L-ON and R-ON; curve c, MB

hybridized with L-ON and R-ON in the presence of T4 DNA ligase; curve d, MB hybridized with

a positive control C-ON. All spectra were recorded at 37 °C and the oligonucleotide concentration

of 50 nM



were bound to MB, indeed resulted in the significant increase of MB fluorescence comparable with that obtained by binding to MB of 20-nt-long C-ON. Figure 3.3 shows the

kinetics of the ligation reaction performed by T4 DNA ligase on L-ON and R-ON bound

to MB, with fluorescence intensity being steadily increased with time (curve c) and with

no changes in fluorescence when L′-ON lacking 5′-phosphate was used instead (curve

b). The initial ligation velocity showed a linear relationship with the concentration of T4

DNA ligase in the range from 0.175 to 35 U/mL (R = 0.9914; corresponding graphs not

shown). All these data have laid a foundation for the experiments described below.



3.2



Evaluation of Ligation Efficiencies of T4 RNA Ligase 2

for Different Duplex Substrates



In the RCA-based miRNA analysis, T4 RNA ligase 2 covalently joins the two separate DNA strands, the ends of padlock probe, which are juxtaposed when forming

duplex with miRNA (Fig. 3.1a). To ensure the correct and efficient circularization

of the padlock probes, we examined the ligation efficiencies of T4 RNA ligase 2 on

different RNA/DNA heteroduplex substrates using the MB-based assay similar to

that described above except that now the loop region of molecular beacon consists

of RNA nucleotides to mimic the targeted miRNA, and the L-ON and R-ON around

the nick are either RNA or DNA nucleotides (Table 3.2).



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

6 Measurement of the Accuracy of the Fusion DNA Polymerases

Tải bản đầy đủ ngay(0 tr)

×