Tải bản đầy đủ - 0 (trang)
2 Isolation and Characterization of “Dehalobium chlorocoercia” Strain DF-1

2 Isolation and Characterization of “Dehalobium chlorocoercia” Strain DF-1

Tải bản đầy đủ - 0trang

566



H.D. May and K.R. Sowers



Fig. 24.1  TEM micrographs of negatively stained “D. chlorocoercia” strain DF-1.

Bar = 0.1 µm. Right panel reprinted with permission from (May et al. 2008). Copyright 2008

American Society for Microbiology



“D. chlorocoercia” strain DF-1 is closely related to D. mccartyi within the

organohalide respiring Chloroflexi. Strain DF-1 is an ultramicrobacterium with

cells 75–339 nm in diameter when grown with 2,3,4,5-tetrachlorobiphenyl and

often observed in clusters (Fig. 24.1). The small cell size may reflect the slow

growth rates, but it would also maximize the membrane surface area-to-volume

ratio, which would be an advantage for uptake of hydrophobic compounds such as

a PCBs. Electron micrographs of the organism also reveal a possible matrix structure surrounding the cells, which if hydrophobic, would be consistent with the tendency of the organisms to clump or cluster. “D. chlorocoercia” strain DF-1 was the

first organohalide respiring bacterium shown to link its growth to reductive dechlorination of PCBs in pure culture (May et al. 2008a, b). This strain requires hydrogen or formate as an electron donor and select organohalides as electron acceptors

(May et al. 2008a, b). Growth and organohalide respiration by strain DF-1 is

restricted to the dechlorination of PCB congeners with doubly flanked meta and

para chlorines, but the microorganism is also capable of dechlorinating chlorobenzenes with doubly flanked chlorines (Wu et al. 2002a) and PCE and TCE to a mixture of cis- and trans-1,2-dichloroethene in a ratio of 1.2-1.7 (Miller et al. 2005).

More recently, D. mccartyi strain CBDB1 was also reported to dechlorinate TCE

to a mixture of cis- and trans-1,2-dichloroethene in a ratio of 0.3 (Marco-Urrea

et al. 2011). Prior to these reports high amounts of trans-dichloroethene had only

been observed in sediment enrichments and environmental samples. This observation suggests that organohalide respiring microorganisms similar to strain DF-1

and D. mccartyi strain CBDB1 are a potential source of trans-DCE, which is often

detected in the environment. The optimal temperature range for growth is 30–33 °C

with no growth or dechlorination observed at 10 or 35 °C. The pH optimum is 6.8

with growth observed in the range of 6.5–8.0. “D. chlorocoercia” strain DF-1 is



24 “Dehalobium chlorocoercia” DF-1—from Discovery to Application



567



osmotolerant and will grow and dechlorinate in the presence of NaCl concentrations ranging from 0.05 to 0.75 M and optimally in NaCl concentrations of 0.1–

0.5 M (May et al. 2008a, b). The latter may be expected since the microorganism

originated from a tidal estuary of Charleston Harbor that daily receives fresh water

from the Ashley River and marine water from the Atlantic Ocean. The genome of

“D. chlorocoercia” strain DF-1 (JGI project Gp0001256; NCBI Sequence Read

Archive SRX018006) has been sequenced, but is not yet closed. Current efforts

to annotate the genome have revealed the presence of multiple putative reductive

dehalogenase genes, one of which is described below as a target for species specific monitoring of “D. chlorocoercia” strain DF-1 in environmental samples.



24.3 Stable Carbon Isotopic Fractionation of PCBs

Stable carbon isotopic fractionation conducted with “D. chlorocoercia” strain

DF-1 shows that the δ13C values during the microbial reductive dechlorination of

2,3,4,5-tetrachlorobiphenyl to 2,3,5-trichlorobiphenyl in enrichment cultures were

relatively constant indicating no measurable isotopic effect (Drenzek et al. 2001).

In the same study, it was reported that compound-specific δ13C analysis performed

for every congener in Aroclor 1268 showed an isotopic trend of decreasing 13C

abundance chlorine content increased, which is similar to observations for other

commercial PCB mixtures. Overall, the study indicated that microbial dechlorination of PCBs in contaminated sediments will generate congener products with

more depleted δ13C values than those in the original Aroclor mixtures of similar

chlorination. Similarly, no isotopic fractionation was observed for δ37Cl during

the dechlorination of 2,3,4,5-tetrachlorobiphenyl by enrichment cultures with “D.

chlorocoercia” (Drenzek et al. 2004). The bulk δ37Cl composition should be insensitive to the preferential loss of less chlorinated (more soluble) congeners before

sedimentary deposition. In this case, other factors that might produce an isotope

effect, such as sequential phase partitioning or chemical breakdown are implicated. This provides a means to discriminate between alteration of PCB congener profiles produced from abiotic weathering (depleted bulk δ37Cl) and reductive

dechlorination (unaffected bulk δ37Cl). The combined results indicate that transformation of PCBs by reductive dechlorination can be discriminated from abiotic

transformations by the absence of a measurable isotope effect during microbial

PCB dechlorination. This absence of isotopic fractionation may prove equally valuable for discriminating these processes because of systematic internal variations

in the δ13C and δ37Cl values of congeners in Aroclors and other PCB mixtures.

The δ13C and values of congeners in Aroclor 1242 and 1254 as well as other commercial PCB mixtures generally decrease with increasing chlorine content (Jarman

et al. 1998). If laboratory results with “D. chlorocoercia” strain DF-1 accurately

reflect activities in the field, then microbial reductive dechlorination will result in

congeners with more negative δ13C values than indigenous PCBs exhibiting the

same degree of chlorination (Fig. 24.2).



H.D. May and K.R. Sowers



568



General isotopic trend

for any Aroclor mixture



13



δ C(‰)



Fig. 24.2  Conceptual plot

showing how PCBs formed

from reductive dechlorination

will be isotopically depleted

relative to native PCBs

of similar chlorination.

Reprinted with permission

from (Drenzek et al. 2001).

Copyright 2001 American

Chemical Society



Reductive Dechlorination



Number of Chlorines



24.4 Detection and Monitoring of “D. chlorocoercia”

Strain DF-1

“D. chlorocoercia” strain DF-1 can be monitored in cultures and environmental samples using selective primers and polymerase chain reaction (PCR) amplified gene targets from total DNA. DNA from organohalide respiring bacteria can

be extracted from 0.1 ml of sediment-free culture with Instagene matrix (BioRad Laboratories) (Lombard et al. 2014) or from 0.25 g of sediment (wet wt)

in a PowerBead microfuge tube with a Power Soil DNA Isolation Kit (MOBIO

Laboratories, Inc.) (Payne et al. 2011). PCR primers Chl348F and Dehal884R

amplify 16S rRNA gene fragments from strain o-17, “D. chlorocoercia” strain

DF-1, phylotype DEH10, and D. mccartyi strain 195, but not Chloroflexus aurantiacus, which is outside of the known clade of organohalide respiring Chloroflexi

(Fagervold et al. 2005). PCR products also are not detected for species outside of

the Chloroflexi, including those from several bacterial and archaeal phyla. This

primer set is effective for qualitative detection and monitoring of “D. chlorocoercia” strain DF-1 in mixed communities using denaturing gradient gel electrophoresis (DGGE) (Fagervold et al. 2005) and denaturing HPLC (DHPLC) (Kjellerup

et al. 2008). Since this primer set is not strain DF-1 selective both assays require

a PCR-amplified product of the 16S rRNA gene from strain DF-1 as a standard to

determine the correct migration distance for DGGE or elution time for DHPLC.

This primer set has also been used for enumeration of “D. chlorocoercia” strain

DF-1 in pure or mixed cultures without other organohalide respiring bacteria present using quantitative real-time polymerase chain reaction (qPCR) (Payne et al.

2011; Lombard et al. 2014). A more specific primer, Dehal1265R, was developed

with high similarity values to strains o-17 and DF-1 16S rRNA gene sequences

and was tested in silico (Watts et al. 2005). This specific primer paired with a universal forward primer (Edwards et al. 1989) yields a PCR product of 1215 base

pairs with “D. chlorocoercia” strain DF-1. PCR amplicons are detected only with



24 “Dehalobium chlorocoercia” DF-1—from Discovery to Application



569



Table 24.1  PCR primers for detecting organohalide respiring bacteria

Primer

Univ14F



Sequence 5′-3′

AGAGTTTGATCCTGGCTCAG



Target gene

Universal 16S rRNA



Dehal1265R



GCTATTCCTACCTGCTGTACC



Chl348F



GAGGCAGCAGCAAGGAA



Dehal884R



GGCCGGACACTTAAAGCG



SKFPat9F



GACAATGAGGACCCGGAATT



SKFPat9R



TCCGCCAAAATAACGAACTG



Non-Dehalococcoides

organohalide respiring

Chloroflexi 16S rRNA

Organohalide respiring

Chloroflexi 16S rRNA

Organohalide respiring

Chloroflexi 16S rRNA

DF1 reductive

dehalogenase

DF1 reductive

dehalogenase



References

Edwards et al.

(1989)

Watts

et al. (2005)

Fagervold et al.

(2005)

Fagervold et al.

(2005)

Payne et al.

(2013)

Payne et al.

(2013)



DNA from isolates and phylotypes within the non-Dehalococcoides organohalide

respiring Chloroflexi, including strains o-17 or “D. chlorocoercia” strain DF-1. No

PCR products are detected with other bacteria, including closely related D. mccartyi strains, indicating that the primers are suitable for detecting the o-17/DF-1

group in a microbial community. However, neither of these primer sets is effective for enumerating “D. chlorocoercia” strain DF-1 in an environmental sample if other non-Dehalococcoides organohalide respiring bacteria are present. An

assay that selectively enumerates “D. chlorocoercia” strain DF-1 within a mixed

community was developed with primers SKFPat9F and SKFPat9R, which target a gene encoding a putative reductive dehalogenase in “D. chlorocoercia”

strain DF-1 (Payne et al. 2013). This assay was shown to selectively enumerate

“D. chlorocoercia” strain DF-1 after bioaugmentation in PCB-impacted sediment

mesocosms within a population of indigenous organohalide respiring bacteria. A

summary of relevant primer sets is shown in Table 24.1. The lower detection limit

of the PCR-based assays is approximately 100 target gene copies per ml culture or

gram sediment (wet wt) based on 0.1 ml and 0.25 g samples, respectively.



24.5 Kinetics and Threshold Levels of PCB Organohalide

Respiration

The low rates of natural attenuation for PCBs observed in the environment are

often attributed to low bioavailability caused by several factors (Schwarzenbach

et al. 2002). First, PCBs tend to adsorb strongly to particles, especially organic,

due to high partitioning coefficients that are 1–5 orders of magnitude greater than

that of chlorinated ethenes, which are frequent groundwater contaminants. This

results in a low rate of mobilization into the aqueous phase. Second, depending

on the congener, PCB solubility is up to 550 times lower than the solubility of



570



H.D. May and K.R. Sowers



chlorinated ethenes, depending on the specific congeners. Third, PCBs accumulate and remain relatively stable in soils and aqueous sediments because of their

low vapor pressures. As a result of these characteristics the time required for a

PCB-contaminated site to recover cannot yet be predicted due in part to a lack of

quantitative information on rates of PCB dechlorination in the pore water phase.

Although rates of reductive dechlorination in sediments depend upon the specific activities and abundance of organohalide respiring microbes, in situ activity will also be influenced by the aqueous concentrations of the PCB congeners.

Several published reports suggest that substrates in nonaqueous phase solids or

liquids are unavailable for microbial uptake (Zhang et al. 1998). In early studies,

attempts to estimate dechlorination rates and the minimal threshold concentrations

for organohalide respiration of PCBs involved adding Aroclors above the aqueous saturation range to sediment microcosms and assaying the rates of reductive

dechlorination (Fish 1996; Rhee et al. 2001; Cho et al. 2002, 2003; Abramowicz

et al. 1993). The minimal threshold Aroclor concentration for reductive dechlorination in these studies ranged from 10 to 40 mg kg−1. The range of threshold

values observed in the reports are a reflection of the specific indigenous dechlorinating populations, the different Aroclors added (Aroclor 1242 or 1248) and

the sediment characteristics from different sources, which would affect the bioavailability. In contrast, Payne et al. (2011, 2013) observed dechlorination with

as low as 1.3 mg kg−1 weathered PCBs in sediments after bioaugmentation with

“D. chlorocoercia” strain DF-1, which indicated that low concentrations of PCBs

typically observed in the environment were indeed available for direct microbial

uptake. As these studies indicate, a major challenge with relating dechlorination

rate to PCB concentration in sediment has been accounting for bioavailability differences caused by the association of PCBs to different types of organic matter

(Ghosh et al. 2003). Perhaps a more appropriate metric that accounts for bioavailability to organisms in different sediment matrixes is to measure the dissolved

concentrations of PCBs in the pore water (Peijnenburg and Jager 2003; Friedman

et al. 2009).

Lombard et al. (2014) took advantage of recent advances in the use of polymer phase passive samplers for measurement, and for passive dosing of compounds, to measure PCB dechlorination rates at low, environmentally relevant

aqueous concentrations. Dechlorination rates of 2,3,4,5-tetrachlorobiphenyl to

2,3,5-trichlorobiphenyl by “D. chlorocoercia” strain DF-1 were measured over

a range of 1–500 ng L−1 in sediment-free medium using a steady-state concentration of cells (106 cells mL−1). The dechlorination rates of 2,3,4,5-tetrachlorobiphenyl over a range of initial concentrations were linear indicating first order

rate kinetics (Fig. 24.3). In addition, a minimum concentration threshold for

2,3,4,5-tetrachlorobiphenyl dechlorination was not detected with the size of inoculum used. Previous studies (Fish 1996; Rhee et al. 2001; Cho et al. 2002, 2003)

also reported first order rate kinetics, but the apparent minimal threshold was

several orders of magnitude greater since measurment included both PCBs in the

pore water and those adsorbed to sediment. Furthermore, Lombard et al. (2014)

observed higher rates up to 1000 fold more than reported previously. These rate



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

2 Isolation and Characterization of “Dehalobium chlorocoercia” Strain DF-1

Tải bản đầy đủ ngay(0 tr)

×