Tải bản đầy đủ - 0 (trang)
 Gắn gen VP1 vào vector biểu hiện pET-SUMO và biến nạp vào tế bào E. Coli.

 Gắn gen VP1 vào vector biểu hiện pET-SUMO và biến nạp vào tế bào E. Coli.

Tải bản đầy đủ - 0trang

Tiến hành nhặt nuôi 3 khuẩn lạc trên môi trƣờng LB có bổ sung kháng sinh

kana 30µg/ ml tách thu plasmid theo kit của Invitrogen. Sản phẩm plasmid đƣợc

điện di kiểm tra trên bản gel agarose 1% hình 3.9.



Hình 3.9: Sản phẩm tách và tinh sạch plasmid của khuẩn lạc số 1,2,3

Plasmid đƣợc tách bằng kit của Invotrogen khi đọc trình tự và phân tích bằng

phần mềm bioedit, gen VP1 có trình tự nhƣ sau.

 Trình tự đoạn gen VP1 thu nhận đƣợc sau khi xử lý bằng phần mềm bioedit:

1



ACCACCTCCACAGGTGAGTCGGCCGATCCCGTTACTGCCACTGTTGAGAACTACGGTGGC



61 GAGACACAGGTCCGGAGACGCCAACACACGGATGTCTCTTTCATATTAGACAGATTTGTG



60

120



121 AAAGTAACACCAAAAGACCAAATTAATGTGTTGGACCTGATGCAAACCCCCGCGCACACC 180

281 TTGGTGGGAGCGCTCCTCCGCACTGCCACCTACTACTTCGCAGATTTAGAAGTGTCAGTG 240

241 AAACACGAGGGGAACCTCACCTGGGTCCCAAACGGGGCGCCTGAGACGGCGTTGGACAAC 300

301 GCACCGCACCGTGTTCTGGCTACTGTTTACAACGGGGGCTGTAGGTACGGCGCGAGCCCC 420

421 GTGACCAACGTGAGGGGTGACCTACAAGTGTTGACCCCGAAGGCGGCAAGAACGCTGCCC 480

481 ACCTCCTTCAACTACGGTGCCATCAAAGCCACTCAGGTGACTGAACTGCTTTACCGCATG 540

541 AAGAGGGCCGAAACATACTGCCCCCGGCCTCTTTTGGCCATCCACCCGAGTGAAGCTAGA 600

601 CGCAAGCAAAAGATTGTGGCACCTGTGAAACAGCTTTTG 639



46



3.3. BIỂU HIỆN VECTOR PET-SUMO-VP1 TRONG TẾ BÀO E.COLI BL21

(DE3)



Protein mã hóa bởi gen VP1 là một protein vỏ có vai trò quan trọng nhất

trong việc gây bệnh, cũng nhƣ là loại kháng ngun chính tạo ra kháng thể chống

lại bệnh LMLM. Vì thế, ngƣời ta đã tiến hành giải mã nucleotit của 1 phần hoặc

tồn bộ gen mã hố VP1 để phân chia chúng ra thành các serotype.

Một protein khi đƣợc biểu hiện ra có hoạt tính phụ thuộc vào rất nhiều yếu tố

trong đó một trong những yếu tố cần quan tâm để protein có hoạt tính là nhiệt độ

biểu hiện. Vi vậy chúng tôi đã khảo sát điều kiện biểu hiện chủng E. coli BL21

(DE3) mang gen VP1 ở 18oC, 25oC và 30oC sau 6h thu mẫu, chạy điện di trên bản

gel SDS-Page 12% (Hình 1)



kDa



M



1



2



3



4



75



63



48

35

25



20

17



11



Hình 3.10 : Biểu hiện gen VP1 ở 18oC và thu mẫu sau 3h,6h, 9h

cảm ứng

11M: Maker protein của GangNam-Pink

1: Protein VP1 biểu hiện ở 18 oC thu mẫu sau 3h cảm ứng IPTG

2: Không cảm ứng

3, 4: Cảm ứng biểu hiện ở 18oC và thu mẫu sau 6h, 9h cảm ứng

IPTG

47



Kết quả biểu hiện hình 3.10 cho thấy ở cả 3 thời điểm thu mẫu cảm ứng biểu

hiện protein đều thấy xuất hiện băng protein có kích thƣớc khoảng 24kDa cộng

15kDa protein SUMO-His-Tag. Nhƣ vậy sản phẩm protein tái tổ hợp mỗi loại tạo ra

có kích thƣơc khoảng 39kDa. Tuy nhiên ở đƣờng chạy số 3, nhiệt độ cảm ứng biểu

hiện là 18oC, sau 6h thu mẫu cho lƣợng protein là nhiều hơn cho thấy khoảng thời

gian thu mẫu để đạt lƣợng protein tối đa là 6h

 Khảo sát nhiệt độ thu mẫu để lượng protein tạo ra lớn nhất

Để đảm bảo protein tạo ra đặt hiệu quả cao, ngoài thời điểm thu mẫu, chúng tôi

cũng khảo sát nhiệt độ biểu hiện protein VP1. Một trong những yếu tố đáng chú ý

để protein tạo ra có hoạt tính. Vì vậy chúng tơi biểu hiện vactor pET-SUMO tái tổ

hợp mang gen VP1 ở các nhiệt độ 18oC, 20oC, 25oC. Kết quả biểu hiện chạy kiểm

tra trên bản gen SDS-PAGE 12% hình 3.11

kDa



M



1



2



3



4



75



75

63

48

35

25



20



17

11



Hình 3.11 : Kết quả kiểm tra lượng protein VP1 tạo ra khi biểu hiện ở

18 oC, 20 oC và 25 oC

1, 2, 3: Cảm ứng biểu hiện thu protein sau 6h,

o

4:18

Mẫu

cảm

Kết quả biểu hiện protein ở

C, không

20oC và

25oứng

C, thu mẫu sau cảm ứng 6h.

M: Maker protein của GangNam-Pink

48



Hình 3.11 cho thấy ở 18oC sau 6h cảm ứng đều có sự biểu hiện protein đích,

thu mẫu cho lƣợng protein là lớn nhất. Vậy có thể thấy với điều kiện biểu hiện là

18oC sau 6h thu mẫu cho hàm lƣợng protein VP1 là lớn nhất.

3.4 TINH SẠCH PROTEIN VP1 BẰNG ĐUÔI HIS-TAG

Do protein VP1 đƣợc biểu hiện ra chủ yếu nằm trong pha dịch, vì vậy, sau khi

siêu âm phá màng tế bào để thu dịch chiết, chúng tơi đã ly tâm loại bỏ tồn bộ phần

xác tế bào và cho pha dịch trực tiếp đi qua cột sắc ký ái lực NiNTA. Do VP1 đƣợc

biểu hiện bằng hệ thống vector biểu hiện pET-SUMO nên protein tạo ra sẽ đƣợc

dung hợp với 1 trình tự gồm 6 amino axit histidine. Trình tự His-tag này sẽ giúp

protein tái tổ hợp kết bám vào cột sắc ký, trong khi các protein khác sẽ bị loại bỏ

bằng dung dịch rửa chứa Imidazol 30 mM. Sau khi đã rửa sạch các protein tạo liên

kết không đặc hiệu với cột sắc ký, protein VP1 đƣợc đẩy theo phân đoạn bằng dung

dịch đệm chứa Imidazol 250 mM. Kết quả thu đƣợc trên bản điện di SDS-PAGE

cho thấy protein VP1 tái tổ hợp đã đƣợc thu lại ở dạng tinh sạch, có kích thƣớc 39

kDa, tƣơng ứng với kích thƣớc tính tốn lý thuyết.



Hình 3.12: Điện di đồ protein VP1 sau khi tinh sạch



49



Để xác định protein, chúng tôi biểu hiện và tinh sạch đƣợc là protein dung

hợp VP1/His-tag, chúng tôi đã tiến hành kĩ thuật thẩm tách miễn dịch (Western

blot), sử dụng kháng thể kháng trình tự His-tag với nồng độ pha loãng 1:25000. Kết

quả cho thấy, trong dịch chiết tế bào, chúng tơi đã thu đƣợc băng protein có kích

thƣớc khoảng 39 kDa, tƣơng ứng với kích thƣớc lí thuyết của protein VP1

SUMO/His-tag (hình 3.12) , chứng tỏ protein vỏ VP1 của virus LMLM mã hóa bởi

gen VP1 đã đƣợc biểu hiện thành công trong tế bào E.coli BL21 (DE3).



50



KẾT LUẬN VÀ KIẾN NGHỊ

I. Kết luận.

Qua các kết quả nghiên cứu đƣợc trình bày ở trên chúng tơi xin rút ra một số

kết luận nhƣ sau:

+/ Đã tách dòng thành cơng gen mã hóa protein vỏ VP1 của virus LMLM

type O ở Việt Nam.

+/ Biểu hiện thành công gen VP1 mã hóa protein vỏ virus LMLM type O ở

Việt Nam.

+/ Đã tinh sạch đƣợc protein VP1 của virus LMLM type O ở Việt Nam.

II. Kiến nghị.

Tiếp tục nghiên cứu protein tái tổ hợp VP1 đƣợc tạo ra nhƣ cắt đuôi

SUMO/His-Tag trong điều kiện nào để protein vỏ VP1 vẫn giữ đƣợc hoạt tính tốt.

thử đáp ứng miễn dịch của protein VP1 đánh giá hoạt tính protein đích thu đƣợc.



51



TÀI LIỆU THAM KHẢO

Tài liệu tiếng Việt.

1. Báo cáo tổng kết công tác phòng chống dịch bệnh gia súc, gia cầm năm

2011. Đào Trọng Đạt (2000). Góp phần vào việc đấu tranh phòng chống

bệnh lở mồm long móng. Tạp chí Khoa học Kỹ thuật Thú y, 2 (7): 6-7.

2. Cao Thùy Chi: Mơ tả cấu trúc virus lở mồm long móng – luận văn thạc sỹ.

Đai học Nông nghiệp Hà Nội. 2006.

3. Chiến lƣợc phát triển chăn nuôi đến năm 2020 do Thủ tƣớng Chính phủ phê

duyệt tại Quyết định số 10/2008/QĐ – TTg ngày 16/01/2008

4. Cục Thú y (2010). Báo cáo kết quả thực hiện Chƣơng trình quốc gia khống

chế và thanh toán bệnh LMLM giai đoạn I (2006-2010), đề xuất giai đoạn II

(2011-2015).

5. Cục Thú y (2011). Chƣơng trình quốc gia khống chế bệnh lở mồm long

móng giai đoạn II (2011-2015). Cục Thú y (2012).

http://dx.doi.org/10.3201/eid1803.110908

6. Hoàng Văn Nam, Văn Đăng Kỳ: Tình hình bệnh lở mồm long móng trên thế

giới hiện nay ( 1999 – 5/2000) – Tạp chí KHKT Thú y, tập VII, số 3 – 2000

số chuyên đề về bệnh lở mồm long móng ( Tr 99).



Tài liệu tiếng Anh.

7. Alexandersen, S., Zhang, Z., Donaldson, A. I. & Garland, A. J. (2003). The

pathogenesis and diagnosis of foot-and-mouth disease. J Comp Pathol

129(1): 1-36.

8. Bac-to-Bac® Baculovirus Expression System. An efficient site-specific

transposition system to generate baculovirus for high-level expression of

recombinant proteins. Catalog nos. 10359-016, 10360-014, 10584-027,

10712-024

9. Baxt B, Donald O. Morgan, Betty H. Robertson, and Charles A. Timone

Epitopes on Foot-and-Mouth Disease Virus Outer Capsid Protein VP1

52



Involved in Neutralization and Cell Attachment J Virology, 1984, 51(2):

298-305.

10. Cao Y, Pu Sun, Yuanfang Fu, Xingwen Bai, Feipen Tian, Xiangtao Liu,

Zengjun Lu, Zaixin Liu (2010) Formation of virus-like particles from O-type

foot-and-mouth disease virus in insect cells using codon-optimized synthetic

genes Biotechnol Lett 32:1223 - 1229 DOI 10.1007/s10529-010-0295-8

11. Cao Y, Zengjun Lu, Jiachuan Sun, Xingwen Bai, Pu Sun, Huifang Bao,

Yingli Chen, Jianhong Guo, Dong Li, Xiangtao Liu, Zaixin Liu (2009)

Synthesis of empty capsid-like particles of Asia I foot- and-mouth disease

virus in insect cells and their immunogenicity in guinea pigs Veterinary

Microbiology 137: 10–17doi:10.1016/j.vetmic.2008.12.007

12. Chien-Der Lee, Yao-Pei Yan, Shu-Mei Liang and Ting-Fang Wang (2009).

Production of FMDV virus-like particles by a SUMO fusion protein

approach in Escherichia coli. Journal of Biomedical Science, 10.1186/14230127-16-69

13. Chunhe Guo, Chunhong Zhang, Hongyu Zheng, Yumao Huang. (2013)

Recombinant adenovirus expression of FMDV P1-2A and 3C protein and its

immune response in mice. Research in Veterinary Science 95 736–741

14. Chien Der Lee, Hui chien Sun, Su Ming Hu, Ching-Feng Chiu, Atthachai

HomHuan,



Shu-MeiLiang,



Chihih-Hsiang



Leng,



and



Ting-Fang



Wang.( April 3, 2008). An improved SUMO fusion protein system for

effective production of native proteins

15. Cocks, P., Abila, R., Bouchot, A., Benigno, C., Morzaria, S., Inthavong, P.,

Long, N.V., Luthi, N.B., Scoizet, A. and Sieng, S. (2009). Study on CrossBorder movement and market chains of large ruminants and pigs in the

Greater Mekong SubRegion.

16. Crisci Elisa , Juan Bárcena, María Montoya (2012) Virus-like particle-based

vaccines



for



animal



viral



infections.



http://dx.doi.org/10.1016/j.immuno.2012.08.002



53



Immunologia



17. Goodwin S, Tobias J. Tuthill, Armando Arias, Richard A. Killington, and

David J. Rowlands (2009) Foot-and-Mouth Disease Virus Assembly:

Processing of recombinant Capsid Precursor by Exogenous Protease Induces

Self-Assembly of Pentamers In Vitro in a Myristoylation-Dependent Manner

J Virol, 83(21): 11275–11282 doi:10.1128/JVI.01263-09

18. Grubman MJ, Mauro P Moraes, Christopher Schutta, Jose Barrera, John

Neilan, Damodar Ettyreddy, Bryan T Butman, Douglas E Brough & David

A Brake Adenovirus serotype 5-vectored foot-and-mouth disease subunit

vaccines: the first decade Future Virol. (2010) 5(1), 51–64

19. Hema M, D Chandran, SB Nagendrakumar, M Madhanmohan, and VA

Srinivasan Construction of an infectious cDNA clone of foot-and-mouth

disease virus type O1 BFS 1860 and its use in the preparation of candidate

vaccine . Biosci. 34(1), 2009 http://www.ias.ac.in/jbiosci



20.Hosmer D.W. and Lemeshow, S. (2000). Applied logistic regression. 2 nd

ed. JonWiley and Sons Inc., New York, p.91-143.

21. FAO Report 2013: Foot-and-Mouth Disease situation.

22. Feng Q, Xi Chen, Ou Ma, Yingying Liu, Mingxiao Ding, Richard A. Collins,

Lung-Sang Ko, Jun Xing, Lok-Ting Lau, Albert Cheung-Hoi Yu, and

Jianguo Chen Serotype and VP1 gene sequence of a foot-and-mouth disease

virus from Hong Kong (2002) Biochemical and Biophysical Research

Communications 30 (2003) 715–721

23. Fleiss. J. L. (1981). Statistical methods for rates and proportions. John Wiley

and Sons Inc., New York, p. 17-338.

24. Fry EE, Stuart DI, Rowlands DJ (2005) The structure of foot-and-mouth

disease virus. Curr Top Microbiol Immunol.,288, 71-101.



25.Van Phan Le:heterogeneity and genetic variations of serotype O and Asia1

foot-and-mouth disea viruses isolated in Viet Nam. Foreign Animal Disease

Division, National Veterinary Reseach and Quarantine Service Anyanng,

Gyeonggi 430-757, Republic of Korea. 10/2009.



54



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

 Gắn gen VP1 vào vector biểu hiện pET-SUMO và biến nạp vào tế bào E. Coli.

Tải bản đầy đủ ngay(0 tr)

×