Tải bản đầy đủ
2: Mutations Are Potentially Caused by a Number of Different Natural and Unnatural Factors

2: Mutations Are Potentially Caused by a Number of Different Natural and Unnatural Factors

Tải bản đầy đủ

330

Chapter 13

Table 13.3 Mutation rates of different genes in different organisms
Organism

Mutation

Rate

Bacteriophage T2

Lysis inhibition

1 ϫ 10Ϫ8

Escherichia coli

Neurospora crassa

Drosophila

Host range

3 ϫ 10

Lactose fermentation

2 ϫ 10Ϫ7

Histidine requirement

Ϫ8

2 ϫ 10

Inositol requirement

8 ϫ 10Ϫ8

Human

Per asexual spore

4 ϫ 10

Kernel color

2.2 ϫ 10Ϫ6

Per gamete

Ϫ5

Per gamete

4 ϫ 10

Eye color

Ϫ6

5.14 ϫ 10

4.5 ϫ 10Ϫ5

Albino coat color

Per gamete

Ϫ5

Dilution coat color

3 ϫ 10

Huntington disease

1 ϫ 10Ϫ6

Per gamete

Ϫ5

Achondroplasia

1 ϫ 10

Neurofibromatosis (Michigan)

1 ϫ 10Ϫ4

Hemophilia A (Finland)

3.2 ϫ 10Ϫ5

Duchenne muscular dystrophy (Wisconsin)

9.2 ϫ 10Ϫ5

The primary cause of spontaneous replication errors was
formerly thought to be tautomeric shifts, in which the positions of protons in the DNA bases change. Purine and pyrimidine bases exist in different chemical forms called tautomers
(Figure 13.10a). The two tautomeric forms of each base are
in dynamic equilibrium, although one form is more common
than the other. The standard Watson-and-Crick base pairings—adenine with thymine, and cytosine with guanine—are
between the common forms of the bases, but, if the bases are
in their rare tautomeric forms, other base pairings are possible (Figure 13.10b).
Watson and Crick proposed that tautomeric shifts might
produce mutations, and, for many years, their proposal was the
accepted model for spontaneous replication errors. However,
there has never been convincing evidence that the rare tautomers are the cause of spontaneous mutations. Furthermore,
research now shows little evidence of tautomers in DNA.
Mispairing can also occur through wobble, in which
normal, protonated, and other forms of the bases are able to
pair because of flexibility in the DNA helical structure
(Figure 13.11). These structures have been detected in DNA
molecules and are now thought to be responsible for many
of the mispairings in replication.
When a mismatched base has been incorporated into a
newly synthesized nucleotide chain, an incorporated error
is said to have occurred. Suppose that, in replication,
thymine (which normally pairs with adenine) mispairs with

Per cell division

Ϫ8

Allozymes
Mouse

Per replication

Ϫ9

Adenine requirement
Corn

Unit

guanine through wobble (Figure 13.12 on page 332). In the
next round of replication, the two mismatched bases separate, and each serves as template for the synthesis of a new
nucleotide strand. This time, thymine pairs with adenine,
producing another copy of the original DNA sequence. On
the other strand, however, the incorrectly incorporated guanine serves as the template and pairs with cytosine, producing a new DNA molecule that has an error—a C . G pair in
place of the original T . A pair (a T . A S C . G base substitution). The original incorporated error leads to a replicated
error, which creates a permanent mutation, because all the
base pairings are correct and there is no mechanism for
repair systems to detect the error.
Mutations due to small insertions and deletions also can
arise spontaneously in replication and crossing over. Strand
slippage can occur when one nucleotide strand forms a
small loop (Figure 13.13 on page 332). If the looped-out
nucleotides are on the newly synthesized strand, an insertion
results. At the next round of replication, the insertion will be
replicated so that both strands contain the insertion. If the
looped-out nucleotides are on the template strand, then the
newly replicated strand has a deletion, and this deletion will
be perpetuated in subsequent rounds of replication.
Another process that produces insertions and deletions is
unequal crossing over. During normal crossing over, the
homologous sequences of the two DNA molecules align, and
crossing over produces no net change in the number of

Gene Mutations, Transposable Elements, and DNA Repair

13.10 Purine and pyrimidine bases exist in different forms

(a)
Rare forms

Common forms
Proton shift
O
H3C

OH
H3C

H

T

N

Thymine

H

H
OH

O

H

N

G

H

N

N

N

N

NH2

Guanine

H
H

N

G

H

N

O

N

H

O

N

H

N

T

NH2

N

H

H

H

N

N

H

H

H

C
H

N

C
O

N

H

H

H

H

N

N
N

A

H

N

O

N

Cytosine

H
H

N

H

N

N

N

N

H

Adenine

H

N

A

H

N

H

H

Standard base-pairing arrangements
H
H

O

T

H

N

N

N

A

N

H

H

N

Concepts

✔ Concept Check 4
How does an incorporated error differ from a replicated error?

N

N

nucleotides in either molecule. Misaligned pairing can cause
unequal crossing over, which results in one DNA molecule
with an insertion and the other with a deletion (Figure 13.14).
Some DNA sequences are more likely than others to undergo
strand slippage or unequal crossing over. Stretches of repeated
sequences, such as trinucleotide repeats or homopolymeric
repeats (more than five repeats of the same base in a row), are
prone to strand slippage. Duplicated or repetitive sequences
may misalign during pairing, leading to unequal crossing over.
Both strand slippage and unequal crossing over produce
duplicated copies of sequences, which in turn promote further
strand slippage and unequal crossing over.

Spontaneous replication errors arise from altered base structures
and from wobble base pairing. Small insertions and deletions can
occur through strand slippage in replication and through unequal
crossing over.

(b)

H3C

called tautomers. (a) A tautomeric shift takes place when a proton
changes its position, resulting in a rare tautomeric form. (b) Standard
and anomalous base-pairing arrangements that arise if bases are in
the rare. tautomeric forms. Base mispairings due to tautomeric shifts
were originally thought to be a major source of errors in replication,
but such structures have not been detected in DNA, and most
evidence now suggests that other types of anomalous pairings
(see also Figure 13.11) are responsible for replication errors.

H

O

Thymine (common form)

Adenine (common form)

Non-Watson-and-Crick base pairing

H
N

H

C

H

H

N

O

H

H

N
N

G

N

N

T

H

N
O

H

O

H3C

N

O

H

N

N

N

O

H

Cytosine (common form)

N

Guanine (common form)

H

Anomalous base-pairing arrangements
H

N

H

C

H

N

N

N

H

T

N

H

O

N
N
H

Thymine (common form)

H

O

H

N

N

+

N

N

A
N

H
N

G

N

H

N

H

N

N
O

H

N

Adenine (commom form)
H

O

H3C

C

H

H

Cytosine (rare form)

N

H

N
O

H
H

N

A

N

H

H

H

N

N

Thymine–guanine wobble

H

H

N

G

N

H

Guanine (rare form)

Cytosine–adenine protonated wobble

13.11 Nonstandard base pairings can occur as a result of
the flexibility in DNA structure. Thymine and guanine can pair
through wobble between normal bases. Cytosine and adenine can pair
through wobble when adenine is protonated (has an extra hydrogen).

331

332

Chapter 13

1 DNA strands separate
for replication.

2 Thymine on the original template strand base pairs with
guanine through wobble, leading to an incorporated error.

TTCG
AAG C

TTCG
AAG C

Wild type

AGGC

TCCG
AGG C

Mutant

TTC G
A G GC

TTCG

DNA

TTCG

Wild type
TT CG
AAG C

AAG C

Wild type 3 At the next round of replication, the guanine nucleotide
pairs with cytosine, leading to a transition mutation.

13.12 Wobble base pairing leads to a replicated error.

Spontaneous Chemical Changes
In addition to spontaneous mutations that arise in replication, mutations also result from spontaneous chemical
changes in DNA. One such change is depurination, the loss
of a purine base from a nucleotide. Depurination results
when the covalent bond connecting the purine to the 1Ј-carbon atom of the deoxyribose sugar breaks (Figure 13.15a),
producing an apurinic site, a nucleotide that lacks its purine
base. An apurinic site cannot act as a template for a complementary base in replication. In the absence of base-pairing
constraints, an incorrect nucleotide (most often adenine) is
incorporated into the newly synthesized DNA strand opposite the apurinic site (Figure 13.15b), frequently leading to an
incorporated error. The incorporated error is then transformed into a replication error at the next round of replication. Depurination is a common cause of spontaneous
mutation; a mammalian cell in culture loses approximately
10,000 purines every day.
Another spontaneously occurring chemical change that
takes place in DNA is deamination, the loss of an amino
group (NH2) from a base. Deamination can be spontaneous
or be induced by mutagenic chemicals.
Deamination can alter the pairing properties of a base:
the deamination of cytosine, for example, produces uracil

(Figure 13.16a), which pairs with adenine in replication.
After another round of replication, the adenine will pair with
thymine, creating a T.A pair in place of the original C.G pair
(C.G S U.A S T.A); this chemical change is a transition
mutation. This type of mutation is usually repaired by
enzymes that remove uracil whenever it is found in DNA. The
ability to recognize the product of cytosine deamination may
explain why thymine, not uracil, is found in DNA. Some cytosine bases in DNA are naturally methylated and exist in the
form of 5-methylcytosine, which, when deaminated, becomes
thymine (Figure 13.16b). Because thymine pairs with adenine in replication, the deamination of 5-methylcytosine
changes an original C.G pair to T.A (C.G S 5mC.G S T.G
S T.A). This change cannot be detected by DNA repair systems, because it produces a normal base. Consequently,
C.G S T.A transitions are frequent in eukaryotic cells, and
5mC sites are mutation hotspots in humans.

Concepts
Some mutations arise from spontaneous alterations to DNA structure, such as depurination and deamination, which may alter the
pairing properties of the bases and cause errors in subsequent
rounds of replication.

Newly synthesized strand 5’ TACGGACTGAAAA 3’
Template strand 3’ ATGCCTGACTTTTTGCGAAG 5’
1 Newly synthesized
strand loops out,…
A
5’ ACGGACTGAA A 3’
3’ TGCCTGAC T T TTTGCGAA 5’

2 …resulting in the
addition of one
nucleotide on the
new strand.
A
5’ ACGGACTGAA AAACGCTT 3’
3’ TGCCTGACTT TTTGCGAA 5’

AATTAATT
TTAATTAA

3 Template strand
loops out,…

AATTAATT
TTAATTAA

5’ ACGGACTGAA AA 3’
3’ TGCCTGACTT TTGCGAA 5’
T

1 If homologous
chromosomes
misalign during
crossing over,…

Unequal crossing over

4 …resulting in the
omission of one
nucleotide on the
new strand.

2 …one crossover
product contains
an insertion…
AATTAATTAATT
TTAATTAATTAA

5’ ACGGACTGAA AACGCTT 3’
3’ TGCCTGACTT TTGCGAA 5’
T

AATT
TTAA

3 …and the other
has a deletion.

13.13 Insertions and deletions may result from strand

13.14 Unequal crossing over produces insertions and

slippage.

deletions.

Gene Mutations, Transposable Elements, and DNA Repair

(a)

333

(b)

DNA
sugar–phosphate
backbone
5’

2 A nucleotide with the
incorrect base (most often
A) is incorporated into the
newly synthesized strand.

1 In replication, the apurinic site
cannot provide a template for
a complementary base on the
newly synthesized strand.

3 At the next round of
replication, this incorrectly
incorporated base will be
used as a template,…

Bases
Template
strands
AACG

T
Pyrimidine

G
Purine

DNA
TGGC
ACC G

T GC
ACC G

Mutant
TTG C
AACG
Replication

T GC
T GC

Strand
separation

Depurination

G

Strand
separation

AACG
T GC

Apurinic
site

G

4 …leading to
a permanent
mutation.

Replication
ACC G

OH
3’

T GC
AACG

5 A nucleotide is incorporated
into the newly synthesized
strand opposite the apurinic site.

ACCG
TGG C
Normal DNA molecule
(no mutation)

13.15 Depurination (the loss of a purine base from a nucleotide) produces an apurinic site.

Chemically Induced Mutations

incorporated into a newly synthesized DNA strand opposite
guanine. In the next round of replication 5-bromouracil
pairs with adenine, leading to another transition (G.C S
G.5BU S A.5BU S A.T).
Another mutagenic chemical is 2-aminopurine (2AP),
which is a base analog of adenine. Normally, 2-aminopurine
base pairs with thymine, but it may mispair with cytosine,
causing a transition mutation (T.A S T.2AP S C.2AP S
C.G). Alternatively, 2-aminopurine may be incorporated
through mispairing into the newly synthesized DNA opposite
cytosine and then later pair with thymine, leading to a C.G S
C.2AP S T.2AP S T.A transition.
Thus, both 5-bromouracil and 2-aminopurine can produce transition mutations. In the laboratory, mutations
caused by base analogs can be reversed by treatment with the
same analog or by treatment with a different analog.

Although many mutations arise spontaneously, a number of
environmental agents are capable of damaging DNA, including certain chemicals and radiation. Any environmental
agent that significantly increases the rate of mutation above
the spontaneous rate is called a mutagen.

Base analogs One class of chemical mutagens consists of
base analogs, chemicals with structures similar to that of
any of the four standard bases of DNA. DNA polymerases
cannot distinguish these analogs from the standard bases;
so, if base analogs are present during replication, they may
be incorporated into newly synthesized DNA molecules. For
example, 5-bromouracil (5BU) is an analog of thymine; it
has the same structure as that of thymine except that it has
a bromine (Br) atom on the 5-carbon atom instead of a
methyl group (Figure 13.17a). Normally, 5-bromouracil
pairs with adenine just as thymine does, but it occasionally
mispairs with guanine (Figure 13.17b), leading to a transition (T.A S 5BU.A S 5BU.G S C.G), as shown in Figure
13.18. Through mispairing, 5-bromouracil can also be

donate alkyl groups, such as methyl (CH3) and ethyl
(CH3–CH2) groups, to nucleotide bases. For example, ethylmethylsulfonate (EMS) adds an ethyl group to guanine,

(b)

(a)
NH2

NH2

O
H

H

C
H

Alkylating agents Alkylating agents are chemicals that

Deamination

N

N

O

H

U
H

H3C

N

N

C
O

H

N

O
H3C

N

Deamination
O

NH2

Cytosine

13.16 Deamination alters DNA bases.

H

T
H

N

N

NH2

Uracil

5-Methylcytosine
(5mC)

Thymine

O

334

Chapter 13

(a)

(b)
Normal base
O

H3C

T

H

N

Normal pairing

Base analog
O

Br

H

Bu

H

N

N

O

Br
H

Bu

H

N
O

N

H

H

N
N

A

Bu

H

H


H

N

N
O

Adenine

N

G

N

N

H

5-Bromouracil

O

O

Br

N
O

5-Bromouracil

H

N

H

N

O

Thymine

N

Mispairing

H

H

5-Bromouracil (ionized)

N
H

Guanine

13.17 5-Bromouracil (a base analog) resembles thymine, except that it has a bromine
atom in place of a methyl group on the 5-carbon atom. Because of the similarity in their
structures, 5-bromouracil may be incorporated into DNA in place of thymine. Like thymine, 5-bromouracil
normally pairs with adenine but, when ionized, it may pair with guanine through wobble.

producing O6-ethylguanine, which pairs with thymine (Figure 13.19a). Thus, EMS produces C.G S T.A transitions.
Ethylmethylsulfonate is also capable of adding an ethyl group
to thymine, producing 4-ethylthymine, which then pairs with
guanine, leading to a T.A S C.G transition. Because EMS
produces both C.G S T.A and T.A S C.G transitions, mutations produced by EMS can be reversed by additional treatment with EMS. Mustard gas is another alkylating agent.

Deamination In addition to its spontaneous occurrence
(see Figure 13.16), deamination can be induced by some
chemicals. For instance, nitrous acid deaminates cytosine,
creating uracil, which in the next round of replication pairs
with adenine (Figure 13.19b), producing a C.G S T.A transition mutation. Nitrous acid changes adenine into
hypoxanthine, which pairs with cytosine, leading to a
T.A S C.G transition. Nitrous acid also deaminates guanine,
producing xanthine, which pairs with cytosine just as guanine does; however, xanthine can also pair with thymine,
leading to a C.G S T.A transition. Nitrous acid produces
exclusively transition mutations and, because both C.G S

T.A and T.A S C.G transitions are produced, these mutations can be reversed with nitrous acid.

Hydroxylamine Hydroxylamine is a very specific basemodifying mutagen that adds a hydroxyl group to cytosine,
converting it into hydroxylaminocytosine (Figure 13.19c).
This conversion increases the frequency of a rare tautomer
that pairs with adenine instead of guanine and leads to C.G
S T.A transitions. Because hydroxylamine acts only on
cytosine, it will not generate T.A S C.G transitions; thus,
hydroxylamine will not reverse the mutations that it
produces.

Intercalating agents Proflavin, acridine orange, ethidium bromide, and dioxin are intercalating agents (Figure
13.20a), which produce mutations by sandwiching themselves (intercalating) between adjacent bases in DNA, distorting the three-dimensional structure of the helix and
causing single-nucleotide insertions and deletions in replication (Figure 13.20b). These insertions and deletions frequently produce frameshift mutations, and so the mutagenic
effects of intercalating agents are often severe. Because

1 In replication, 5-bromouracil may
become incorporated into DNA in place of
thymine, producing an incorporated error.
3’
3’
3’
5’

GAC
CTG

5’
3’
5’

GAC

5’

Strand
separation

3’
5’

GAC
CBG

5’

3’
5’

GAC
CTG

5’

CBG

3’

Replicated
error

5’
3’

Strand
separation

5’
3’

Incorporated
error

GAC

3 In the next replication, this guanine
nucleotide pairs with cytosine,
leading to a permanent mutation.

3’
3’
5’

GGC
CBG

GGC

5’

CTG

GAC
CTG

5’
3’

5’
2 5-Bromouracil may mispair
with guanine in the next
round of replication.

Conclusion: Incorporation of bromouracil followed by
mispairing leads to a TA
CG transition mutation.

13.18 5-Bromouracil can lead to a replicated error.

GGC
CCG
Mutant

5’
3’

3’
5’

GAC
CBG

5’
3’

Strand
separation

5’
3’

Replication
3’
3’
5’
Replication

3’
5’

CBG

3’
Replication

4 If 5-bromouracil pairs
with adenine, no
replicated error occurs.

Gene Mutations, Transposable Elements, and DNA Repair

Original base

Mutagen

Modified base

Type of
mutation

Pairing partner

H3C CH2
H

O

N
N

G

(a)

N

H

H

EMS

O

N
N

N

N

O

H

H

H

H

N

H

N

Nitrous acid
(HNO2)

O

Deamination

U

H

N

N

(c)

CG

TA

N
H

O

Uracil

Adenine
H

HO

C

Hydroxylamine
(NH2OH)

O

Hydroxylation

N

H

N

H

N

H

N

H

N

N

H

N
N

A
N

N

Cytosine

N

A

N

H

H

N

N

NH2

H

TA

H

Cytosine
H

CG

Thymine

H

O

H

C

TA

O

NH2

N

CG

H

O 6-Ethylguanine

H

H
N

Alkylation

Guanine

H

T

N

N
H

(b)

CH3

O

H

Hydroxylaminocytosine

intercalating agents generate both additions and deletions,
they can reverse the effects of their own mutations.

Concepts
Chemicals can produce mutations by a number of mechanisms.
Base analogs are inserted into DNA and frequently pair with the
wrong base. Alkylating agents, deaminating chemicals, hydroxylamine, and other chemicals change the structure of DNA bases,
thereby altering their pairing properties. Intercalating agents
wedge between the bases and cause single-base insertions and
deletions in replication.

Adenine

can alter DNA bases.

tissues and damaging DNA. These forms of radiation, called
ionizing radiation, dislodge electrons from the atoms that
they encounter, changing stable molecules into free radicals
and reactive ions, which then alter the structures of bases and
break phosphodiester bonds in DNA. Ionizing radiation also
frequently results in double-strand breaks in DNA. Attempts
to repair these breaks can produce chromosome mutations
(discussed in Chapter 7).
(b)

(a)
H

N

H2N

H

H

c. They are similar in structure to the normal bases.

In 1927, Hermann Muller demonstrated that mutations in
fruit flies could be induced by X-rays. The results of subsequent studies showed that X-rays greatly increase mutation
rates in all organisms. Because of their high energies, X-rays,
gamma rays, and cosmic rays are all capable of penetrating

H

NH2

Proflavin

b. They distort the structure of DNA.

Radiation

H
H

a. They produce changes in DNA polymerase that cause it to
malfunction.

d. They chemically modify the normal bases.

H

H

✔ Concept Check 5
Base analogs are mutagenic because of which characteristic?

13.19 Chemicals

H

H

Intercalated
molecule

H

H
H3C

Nitrogenous
bases

N

N

N

CH3

H

H

CH3

CH3

Acridine orange

13.20 Intercalating agents such as proflavin and acridine
orange insert themselves between adjacent bases in DNA,
distorting the three-dimensional structure of the helix and
causing single-nucleotide insertions and deletions in
replication.

335

336

Chapter 13

(a)

PP

Thymine
bases

T

5’

Covalent
bonds

3’
T

P

T

5’

Sugar–phosphate
backbone

T
AG G T G CATC
TCCAAC GTAG

T

(b)

UV light

3’

13.21 Pyrimidine dimers result from ultraviolet light.
(a) Formation of thymine dimer. (b) Distorted DNA.

Ultraviolet (UV) light has less energy than that of ionizing radiation and does not eject electrons and cause ionization but is nevertheless highly mutagenic. Purine and
pyrimidine bases readily absorb UV light, resulting in the
formation of chemical bonds between adjacent pyrimidine
molecules on the same strand of DNA and in the creation of
pyrimidine dimers (Figure 13.21a). Pyrimidine dimers
consisting of two thymine bases (called thymine dimers) are
most frequent, but cytosine dimers and thymine–cytosine
dimers also can form. Dimers distort the configuration of
DNA (Figure 13.21b) and often block replication. Most
pyrimidine dimers are immediately repaired by mechanisms
discussed later in this chapter, but some escape repair and
inhibit replication and transcription.
When pyrimidine dimers block replication, cell division is inhibited and the cell usually dies; for this reason, UV
light kills bacteria and is an effective sterilizing agent. For a
mutation to occur, the replication block must be overcome.
Bacteria can sometimes circumvent replication blocks produced by pyrimidine dimers and other types of DNA damage by means of the SOS system. This system allows
replication blocks to be overcome but, in the process, makes
numerous mistakes and greatly increases the rate of mutation. Indeed, the very reason that replication can proceed in
the presence of a block is that the enzymes in the SOS system do not strictly adhere to the base-pairing rules. The
trade-off is that replication may continue and the cell survives, but only by sacrificing the normal accuracy of DNA
synthesis.

Concepts
Ionizing radiation such as X-rays and gamma rays damage DNA by
dislodging electrons from atoms; these electrons then break phosphodiester bonds and alter the structure of bases. Ultraviolet light
causes mutations primarily by producing pyrimidine dimers that
disrupt replication and transcription. The SOS system enables bacteria to overcome replication blocks but introduces mistakes in
replication.

Detecting Mutations with
the Ames Test
People in industrial societies are surrounded by a multitude
of artificially produced chemicals: more than 50,000 different chemicals are in commercial and industrial use today,
and from 500 to 1000 new chemicals are introduced each
year. Some of these chemicals are potential carcinogens and
may cause harm to humans. One method for testing the cancer-causing potential of chemicals is to administer them to
laboratory animals (rats or mice) and compare the incidence
of cancer in the treated animals with that of control animals.
These tests are unfortunately time consuming and expensive.
Furthermore, the ability of a substance to cause cancer in
rodents is not always indicative of its effect on humans. After
all, we aren’t rats!
In 1974, Bruce Ames developed a simple test for evaluating the potential of chemicals to cause cancer. The Ames
test is based on the principle that both cancer and mutations
result from damage to DNA, and the results of experiments
have demonstrated that 90% of known carcinogens are also
mutagens. Ames proposed that mutagenesis in bacteria
could serve as an indicator of carcinogenesis in humans.
The Ames test uses four auxotrophic strains of the bacterium Salmonella typhimurium that have defects in the
lipopolysaccharide coat, which normally protects the bacteria from chemicals in the environment. Furthermore, the
DNA-repair system in these strains has been inactivated,
enhancing their susceptibility to mutagens.
One of the four auxotrophic strains used in the Ames
test detects base-pair substitutions; the other three detect
different types of frameshift mutations. Each strain carries a
hisϪ mutation, which renders it unable to synthesize the
amino acid histidine, and the bacteria are plated onto
medium that lacks histidine (Figure 13.22). Only bacteria
that have undergone a reverse mutation of the histidine gene
(hisϪ S hisϩ) are able to synthesize histidine and grow on
the medium. Different dilutions of a chemical to be tested
are added to plates inoculated with the bacteria, and the
number of mutant bacterial colonies that appear on each
plate is compared with the number that appear on control
plates with no chemical (i.e., that arose through spontaneous
mutation). Any chemical that significantly increases the
number of colonies appearing on a treated plate is mutagenic
and is probably also carcinogenic.
Some compounds are not active carcinogens but can be
converted into cancer-causing compounds in the body. To
make the Ames test sensitive for such potential carcinogens,
a compound to be tested is first incubated in mammalian
liver extract that contains metabolic enzymes.
The Ames test has been applied to thousands of chemicals and commercial products. An early demonstration of its
usefulness was the discovery, in 1975, that many hair dyes
sold in the United States contained compounds that were
mutagenic to bacteria. These compounds were then removed
from most hair dyes.

Gene Mutations, Transposable Elements, and DNA Repair

Experiment
Question: How can chemicals be quickly screened for
their ability to cause cancer?

his – bacteria
Methods
1 Bacterial his – strains
are mixed with liver
enzymes (which have
the ability to convert
compounds into
potential mutagens).

2 Some of the bacterial
strains are also mixed
with the chemical
to be tested for
mutagenic activity.

13.3 Transposable Elements
Are Mobile DNA
Sequences Capable of
Inducing Mutations
Transposable elements are DNA sequences capable of moving and are found in the genomes of all organisms. In many
genomes, they are quite abundant: for example, they make
up at least 45% of human DNA. Most transposable elements
are able to insert at many different locations, relying on
mechanisms that are distinct from homologous recombination. They often cause mutations, either by inserting into
another gene and disrupting it or by promoting DNA
rearrangements such as deletions, duplications, and inversions (see Chapter 7).

General Characteristics
of Transposable Elements

3 The bacteria are
then plated on
medium that
lacks histidine.

Incubate

Incubate

Control plate
(no chemical)

Treatment plate
(chemical added)

Results

4 Bacterial colonies that appear on the plates
have undergone a his –
his + mutation.
Conclusion: Any chemical that significantly increases the
number of colonies appearing on the treatment plate is
mutagenic and therefore probably also carcinogenic.

13.22 The Ames test is used to identify chemical mutagens.

Concepts
The Ames test uses hisϪ strains of bacteria to test chemicals for
their ability to produce hisϪ S hisϩ mutations. Because mutagenic activity and carcinogenic potential are closely correlated, the
Ames test is widely used to screen chemicals for their cancercausing potential.

There are many different types of transposable elements:
some have simple structures, encompassing only those
sequences necessary for their own transposition (movement), whereas others have complex structures and encode
a number of functions not directly related to transposition.
Despite this variation, many transposable elements have certain features in common.
Short flanking direct repeats from 3 to 12 bp long are
present on both sides of most transposable elements. They
are not a part of a transposable element and do not travel
with it. Rather, they are generated in the process of transposition, at the point of insertion. The sequences of these
repeats vary, but the length is constant for each type of transposable element. The presence of flanking direct repeats
indicates that staggered cuts are made in the target DNA
when a transposable element inserts itself, as shown in
Figure 13.23. The staggered cuts leave short, single-stranded
pieces of DNA on either side of the transposable element.
Replication of the single-stranded DNA then creates the
flanking direct repeats.
At the ends of many, but not all, transposable elements
are terminal inverted repeats, which are sequences from 9 to
40 bp in length that are inverted complements of one another.
For example, the following sequences are inverted repeats:
5Ј–ACAGTTCAG . . . CTGAACTGT–3Ј
3Ј–TGTCAAGTC . . . GACTTGACA–5Ј
On the same strand, the two sequences are not simple inversions, as their name might imply; rather, they are both
inverted and complementary. (Notice that the sequence from
left to right in the top strand is the same as the sequence from
right to left in the bottom strand.) Terminal inverted repeats
are recognized by enzymes that catalyze transposition and are
required for transposition to take place. Figure 13.24 summarizes the general characteristics of transposable elements.

337

1 Staggered cuts are made
in the target DNA.

CGTCGATAG
GCAGCTATC

CGTCGAT
GC

Transposable
element

AG
AGCTATC

2 A transposable element
inserts itself into the DNA.

CGTCGAT
GC

AG
AGCTATC

Gaps filled in by
DNA polymerase

CGTCGAT
GCAGCTA

3 The staggered cuts leave
short, single-stranded
pieces of DNA.

TCGATAG
AGCTATC

Flanking
direct
repeats

4 Replication of this singlestranded DNA creates the
flanking direct repeats.

13.23 Flanking direct repeats are generated when a
transposable element inserts into DNA.

Concepts
Transposable elements are mobile DNA sequences that often
cause mutations. There are many different types of transposable
elements; most generate short flanking direct repeats at the target sites as they insert. Many transposable elements also possess
short terminal inverted repeats.

✔ Concept Check 6

are used for transposition in both prokaryotic and eukaryotic cells. Nevertheless, all types of transposition have several
features in common: (1) staggered breaks are made in the
target DNA (see Figure 13.23); (2) the transposable element
is joined to single-stranded ends of the target DNA; and (3)
DNA is replicated at the single-strand gaps.
Some transposable elements transpose as DNA (instead
of being first copied into RNA, as retrotransposons are) and
are referred to as DNA transposons (also called Class I
transposable elements). Other transposable elements transpose through an RNA intermediate. In this case, RNA is transcribed from the transposable element (DNA) and is then
copied back into DNA by a special enzyme called reverse
transcriptase. Elements that transpose through an RNA
intermediate are called retrotransposons (also called Class
II transposons). Most transposable elements found in bacteria are DNA transposons. Both DNA transposons and retrotransposons are found in eukaryotes, although
retrotransposons are more common.
Among DNA transposons, transposition may be replicative or nonreplicative. In replicative transposition, a new
copy of the transposable element is introduced at a new site
while the old copy remains behind at the original site, and so
the number of copies of the transposable element increases as
a result of transposition. In nonreplicative transposition, the
transposable element excises from the old site and inserts at a
new site without any increase in the number of its copies.
Nonreplicative transposition requires the replication of only
the few nucleotides that constitute the direct repeats.
Retrotransposons use replicative transposition only.

Concepts
Transposition may take place through DNA or an RNA intermediate. In replicative transposition, a new copy of the transposable
element inserts in a new location and the old copy stays behind;
in nonreplicative transposition, the old copy excises from the old
site and moves to a new site.

How are flanking direct repeats created in transposition?

The Mutagenic Effects
of Transposition

Transposition
Transposition is the movement of a transposable element
from one location to another. Several different mechanisms

(a)

Transposable element
TGCAA ATCGCA
ACGTT TAGCGT

Because transposable elements may insert into other genes
and disrupt their function, transposition is generally mutagenic. In fact, more than half of all spontaneously occurring

(b)

Transposable element

TGCGATTGCAA
ACGCTAACGTT

Terminal inverted repeat

Terminal inverted repeat

Flanking direct repeat

Flanking direct repeat

13.24 Many transposable elements have common characteristics. (a) Most transposable elements
generate flanking direct repeats on each side of the point of insertion into target DNA. Many transposable
elements also possess terminal inverted repeats. (b) Representations of direct and indirect repeats.