Tải bản đầy đủ
6: Eukaryotic Chromosomes Are DNA Complexed to Histone Proteins

6: Eukaryotic Chromosomes Are DNA Complexed to Histone Proteins

Tải bản đầy đủ

208

Chapter 8

and transcription, when the two nucleotide strands must
unwind so that particular base sequences are exposed. Thus,
the packing of eukaryotic DNA (its tertiary chromosomal
structure) is not static but changes regularly in response to
cellular processes.

Chromatin Structure
Eukaryotic DNA is closely associated with proteins, creating
chromatin. The two basic types of chromatin are euchromatin, which undergoes the normal process of condensation
and decondensation in the cell cycle, and heterochromatin,
which remains in a highly condensed state throughout the
cell cycle, even during interphase. Euchromatin constitutes
the majority of the chromosomal material and is where most
transcription takes place. All chromosomes have heterochromatin at the centromeres and telomeres. Heterochromatin is
also present at other specific places on some chromosomes,
along the entire inactive X chromosome in female mammals
(see pp. 80–81 in Chapter 4), and throughout most of the Y
chromosome in males. Most, but not all, heterochromatin
appears to be largely devoid of transcription.
The most abundant proteins in chromatin are the histones, which are small, positively charged proteins of five
major types: H1, H2A, H2B, H3, and H4 (Table 8.2). All histones have a high percentage of arginine and lysine, positively charged amino acids that give the histones a net
positive charge. The positive charges attract the negative
charges on the phosphates of DNA; this attraction holds the
DNA in contact with the histones.
A heterogeneous assortment of nonhistone chromosomal proteins make up about half of the protein mass of the
chromosome. Chromosomal scaffold proteins (Figure
8.18), one class of nonhistone chromosomal protein, may
help fold and pack the chromosome. Other structural proteins make up the kinetochore, cap the chromosome ends by
attaching to telomeres, and constitute the molecular motors

8.18 Scaffold proteins play a role in the folding and packing
of chromosomes. [Professor U. Laemmli/Photo Researchers.]

that move chromosomes in mitosis and meiosis. Some types
of nonhistone chromosomal proteins have roles in genetic
processes. They are components of the replication machinery (DNA polymerases, helicases, primases; see Chapter 9)
and proteins that carry out and regulate transcription (RNA
polymerases; see Chapter 10). The highly organized structure of chromatin is best viewed from several levels. In the
next sections, we will examine these levels of chromatin
organization.

Concepts
Chromatin, which consists of DNA complexed to proteins, is the
material that makes up eukaryotic chromosomes. The most abundant of these proteins are the five types of positively charged histone proteins: H1, H2A, H2B, H3, and H4.

✔ Concept Check 9
Neutralizing their positive charges would have which effect on the
histone proteins?
a. They would bind the DNA tighter.

Table 8.2

Characteristics of histone proteins
Molecular
Weight

Number of Amino
Acids

H1

21,130

223

H2A

13,960

129

H2B

13,774

125

H3

15,273

135

H4

11,236

102

Histone Protein

Note: The sizes of H1, H2A, and H2B histones vary somewhat from
species to species. The values given are for bovine histones.
Source: Data are from A. L. Lehninger, D. L. Nelson, and M. M. Cox,
Principles of Biochemistry, 3d ed. (New York: Worth Publishers, 1993),
p. 924.

b. They would separate from the DNA.
c. They would no longer be attracted to each other.
d. They would cause supercoiling of the DNA.

The nucleosome Chromatin has a highly complex structure with several levels of organization (Figure 8.19). The
simplest level is the double-helical structure of DNA. At a
more complex level, the DNA molecule is associated with
proteins and is highly folded to produce a chromosome.
When chromatin is isolated from the nucleus of a cell
and viewed with an electron microscope, it frequently looks
like beads on a string (Figure 8.20a). If a small amount of
nuclease is added to this structure, the enzyme cleaves the
“string” between the “beads,” leaving individual beads
attached to about 200 bp of DNA (Figure 8.20b). If more

DNA: The Chemical Nature of the Gene

DNA double helix

1 At the simplest level, chromatin
is a double-stranded helical
structure of DNA.

2 nm
2 DNA is complexed
with histones to
form nucleosomes.

4 A chromatosome consists
of a nucleosome plus the
H1 histone.

3 Each nucleosome consists of
eight histone proteins around
which the DNA wraps 1.65 times.

Histone H1
Nucleosome core of
eight histone molecules
6 …that forms loops averaging
300 nm in length.

11 nm
Chromatosome

5 The nucleosomes fold up to
produce a 30-nm fiber…

300 nm
30 nm

250-nm-wide fiber

7 The 300-nm fibers are
compressed and folded to
produce a 250-nm-wide fiber.

8 Tight coiling of the 250-nm
fiber produces the chromatid
of a chromosome.

1400 nm

700 nm

8.19 Chromatin has a highly complex structure with several levels of organization.

nuclease is added, the enzyme chews up all of the DNA
between the beads and leaves a core of proteins attached to
a fragment of DNA (Figure 8.20c). Such experiments
demonstrated that chromatin is not a random association
of proteins and DNA but has a fundamental repeating
structure.
The repeating core of protein and DNA produced by
digestion with nuclease enzymes is the simplest level of chromatin structure, the nucleosome (see Figure 8.19). The
nucleosome is a core particle consisting of DNA wrapped
about two times around an octamer of eight histone proteins
(two copies each of H2A, H2B, H3, and H4), much like
thread wound around a spool (Figure 8.20d). The DNA in
direct contact with the histone octamer is between 145 and
147 bp in length.
Each of the histone proteins that make up the nucleosome core particle has a flexible “tail,” containing from 11 to
37 amino acids, that extends out from the nucleosome.
Positively charged amino acids in the tails of the histones
interact with the negative charges of the phosphates on the
DNA, and the tails of one nucleosome may interact with
neighboring nucleosomes. Chemical modifications of these
histone tails bring about changes in chromatin structure that
are necessary for gene expression.

The fifth type of histone, H1, is not a part of the core
particle but plays an important role in the nucleosome structure. H1 binds to 20 to 22 bp of DNA where the DNA joins
and leaves the octamer (see Figure 8.19) and helps to lock the
DNA into place, acting as a clamp around the nucleosome
octamer.
Together, the core particle and its associated H1 histone
are called the chromatosome (see Figure 8.19), the next level
of chromatin organization. Each chromatosome encompasses about 167 bp of DNA. Chromatosomes are located at
regular intervals along the DNA molecule and are separated
from one another by linker DNA, which varies in size among
cell types; in most cells, linker DNA comprises from about 30
to 40 bp. Nonhistone chromosomal proteins may be associated with this linker DNA, and a few also appear to bind
directly to the core particle.

Higher-order chromatin structure When chromatin is
in a condensed form, adjacent nucleosomes are not separated by space equal to the length of the linker DNA; rather,
nucleosomes fold on themselves to form a dense, tightly
packed structure (see Figure 8.19) that makes up a fiber with
a diameter of about 30 nm (Figure 8.21a). Two different
models have been proposed for the 30-nm fiber: a solenoid

209

210

Chapter 8

(a) Core histones
of nucleosome

(a)

Linker DNA

“Beads-on-a-string”
view of chromatin

Nuclease

1 A small amount of
nuclease cleaves the
“string” between
the beads,…

(b)

2 …releasing individual
beads attached to
about 200 bp of DNA.
(b)

Nuclease
3 More nuclease
destroys all of the
unprotected DNA
between the beads,…

(c)

4 …leaving a core of
proteins attached to
145–147 bp of DNA.

11 nm

Individual
nucleosomes

30-nm fiber

8.21 Adjacent nucleosomes pack together to form a 30-nm
fiber. (a) Electron micrograph of nucleosomes. (b) One model of how

(d)

nucleosomes associate to form the helical fiber. [Part a: Jan Bednar,
Rachel A. Horowitz, Sergei A. Grigoryev, Lenny M. Carruthers, Jeffrey C.
Hansen, Abraham J. Koster, and Christopher L. Woodcock. Nucleosomes,
linker DNA, and linker histone form a unique structural motif that directs
the higher-order folding and compaction of chromatin. PNAS 1998;
95:14173–14178. Copyright 2004 National Academy of Sciences,
U.S.A.]

H2A'

H2B

H3
H2B'

H2A

H4

8.20 The nucleosome is the fundamental repeating unit of
chromatin. The space-filling model shows that the nucleosome core
particle consists of two copies each of H2A, H2B, H3, and H4, around
which DNA (white) coils. [Part d: From K. Luger et al., 1997, Nature
389:251; courtesy of T. H. Richmond.]

model, in which a linear array of nucleosomes are coiled, and
a helix model, in which nucleosomes are arranged in a zigzag
ribbon that twists or supercoils. Recent evidence supports
the helix model (Figure 8.21b).
The next-higher level of chromatin structure is a series
of loops of 30-nm fibers, each anchored at its base by proteins in the nuclear scaffold (see Figure 8.19). On average,
each loop encompasses some 20,000 to 100,000 bp of DNA

and is about 300 nm in length, but the individual loops vary
considerably. The 300-nm loops are packed and folded to
produce a 250-nm-wide fiber. Tight helical coiling of the
250-nm fiber, in turn, produces the structure that appears in
metaphase—an individual chromatid approximately 700 nm
in width.

Concepts
The nucleosome consists of a core particle of eight histone proteins
and DNA that wraps around the core. Chromatosomes, which are
nucleosomes bound to an H1 histone, are separated by linker DNA.
Nucleosomes fold to form a 30-nm chromatin fiber, which appears
as a series of loops that pack to create a 250-nm-wide fiber. Helical
coiling of the 250-nm fiber produces a chromatid.

Centromere Structure
The centromere is a constricted region of the chromosome to
which spindle fibers attach and is essential for proper chromosome movement in mitosis and meiosis (see Chapter 2).

DNA: The Chemical Nature of the Gene

The first centromeres to be isolated and studied at the molecular level came from yeast, which has small linear chromosomes. When molecular biologists attached DNA sequences
from yeast centromeres to plasmids, the plasmids behaved in
mitosis as if they were eukaryotic chromosomes. This finding
indicated that the DNA sequences from yeast, called centromeric sequences, are functional centromeres that allow
segregation to take place. Centromeric sequences are the
binding sites for the kinetochore, to which spindle fibers
attach.
The centromeres of different organisms exhibit considerable variation in centromeric sequences. Some organisms
have chromosomes with diffuse centromeres, and spindle
fibers attach along the entire length of each chromosome.
Most have chromosomes with localized centromeres; in
these organisms, spindle fibers attach at a specific place on
the chromosome, but there can also be secondary constrictions at places that do not have centromeric functions. In
Drosophila, Arabidopsis, and humans, centromeres span
hundreds of thousands of base pairs. Most of the centromere
is made up of short sequences of DNA that are repeated
thousands of times in tandem.

Telomere Structure
Telomeres are the natural ends of a chromosome (see p. 20
in Chapter 2). Pioneering work by Hermann Muller (on fruit
flies) and Barbara McClintock (on corn) showed that chromosome breaks produce unstable ends that have a tendency
to stick together and enable the chromosome to be degraded.
Because attachment and degradation don’t happen to the
ends of a chromosome that has telomeres, each telomere
must serve as a cap that stabilizes the chromosome, much
like the plastic tips on the ends of a shoelace that prevent the
lace from unraveling. Telomeres also provide a means of
replicating the ends of the chromosome, which will be discussed in Chapter 9.
Telomeres have now been isolated from protozoans,
plants, humans, and other organisms; most are similar in
structure. These telomeric sequences usually consist of a
series of cytosine nucleotides followed by several adenine or
thymine nucleotides or both, taking the form 5Ј–Cn(A or
T)m–3Ј, where n is 2 or more and m is from 1 to 4. For example, the repeating unit in human telomeres is CCCTAA,
which may be repeated from 250 to 1500 times. The
sequence is always oriented with the string of Cs and Gs
toward the end of the chromosome, as shown here:

Concepts
The centromere is a region of the chromosome to which spindle
fibers attach. Centromeres display considerable variation in
structure. In addition to their role in chromosome movement,
centromeres help control the cell cycle by inhibiting anaphase
until chromosomes are attached to spindle fibers from both
poles.

end of
chromosome

; 5Ј-CCCTAA :
3Ј-GGGATT

toward
centromere

The G-rich strand often protrudes beyond the complementary C-rich strand at the end of the chromosome (Figure
8.22a). Special POT (protection of telomere) proteins bind
to the G-rich single-stranded sequence, protecting the

(a)

5’ CCC TAACCCTAA
3’ GGGATTGGGATTGGGATTGGGATTGGGATT

3’
5’

DNA sequence at
end of chromosome

(b)

t-loop

5’

8.22 DNA at the ends of eukaryotic chro-

G-rich single-strand
overhang
AATCCCAATCCC
TTAGGGTTAGGG 3’
TTAGGG

mosomes consists of telomeric sequences.

3’
5’

(a) The G-rich strand at the telomere is longer
than the C-rich strand. (b) In mammalian cells, the
G-rich strand folds over and pairs with a short
stretch of DNA to form a t-loop.

211

212

Chapter 8

telomere from degradation and preventing the ends of
chromosomes from sticking together. In mammalian cells,
the single-stranded overhang may fold over and pair with a
short stretch of DNA to form a structure called the t-loop,
which also functions in protecting the telomere from degradation (Figure 8.22b).

Concepts
A telomere is the stabilizing end of a chromosome. At the end of
each telomere are many short telomeric sequences.

✔ Concept Check 10
Which is a characteristic of DNA sequences at the telomeres?
a. They consist of cytosine and adenine nucleotides.
b. They consist of repeated sequences.
c. One strand protrudes beyond the other, creating some singlestanded DNA at the end.
d. All of the above.

8.7 Eukaryotic DNA Contains
Several Classes of Sequence
Variation
Eukaryotic organisms differ dramatically in the amount of
DNA per cell, a quantity termed an organism’s C value
(Table 8.3). Each cell of a fruit fly, for example, contains 35
times the amount of DNA found in a cell of the bacterium
E. coli. In general, eukaryotic cells contain more DNA than
prokaryotic cells do, but variability in the C values of different eukaryotes is huge. Human cells contain more than 10
times the amount of DNA found in Drosophila cells, whereas

Table 8.3

Genome sizes of various
organisms

Organism
Lambda (␭) bacteriophage
Escherichia coli (bacterium)
Saccharomyces cerevisiae (yeast)

Approximate
Genome Size (bp)
50,000
4,640,000
12,000,000

Arabidopsis thaliana (plant)

125,000,000

Drosophila melanogaster (insect)

170,000,000

Homo sapiens (human)

3,200,000,000

Zea mays (corn)

4,500,000,000

Amphiuma (salamander)

765,000,000,000

some salamander cells contain 20 times as much DNA as that
in human cells. Clearly, these differences in C value cannot
be explained simply by differences in organismal complexity.
So, what is all this extra DNA in eukaryotic cells doing? We
do not yet have a complete answer to this question, but
eukaryotic DNA sequences reveal a complexity that is absent
from prokaryotic DNA.

Types of DNA Sequences
in Eukaryotes
Eukaryotic DNA consists of at least three types of sequences:
unique-sequence DNA, moderately repetitive DNA, and
highly repetitive DNA. Unique-sequence DNA consists of
sequences that are present only once or, at most, a few times
in the genome. This DNA includes sequences that encode
proteins, as well as a great deal of DNA whose function is
unknown. Genes that are present in a single copy constitute
from roughly 25% to 50% of the protein-encoding genes in
most multicellular eukaryotes. Other genes within uniquesequence DNA are present in several similar, but not identical, copies that arose through the duplication of an existing
gene and are referred to as a gene family. Most gene families
include just a few member genes, but some, such as those
that encode immunoglobulin proteins in vertebrates, contain hundreds of members. The genes that encode ␤ -like
globins are another example of a gene family. In humans,
there are seven ␤ -globin genes, clustered together on chromosome 11. The polypeptides encoded by these genes join
with ␣-globin polypeptides to form hemoglobin molecules,
which transport oxygen in the blood.
Other sequences exist in many copies and are called
repetitive DNA. A major class of repetitive DNA is called
moderately repetitive DNA, which typically consists of
sequences from 150 to 300 bp in length (although they may
be longer) that are repeated many thousands of times. Some
of these sequences perform important functions for the cell;
for example, the genes for ribosomal RNAs (rRNAs) and
transfer RNAs (tRNAs) make up a part of the moderately
repetitive DNA. However, much of the moderately repetitive
DNA has no known function in the cell. Moderately repetitive DNA itself is of two types of repeats. Tandem repeat
sequences appear one after another and tend to be clustered
at a few locations on the chromosomes. Interspersed repeat
sequences are scattered throughout the genome. An example of an interspersed repeat is the Alu sequence, which consists of about 200 bp. The Alu sequence is present more than
a million times in the human genome and apparently has no
ceullar function. Short repeats, such as the Alu sequences, are
called SINEs (short interspersed elements). Longer interspersed repeats consisting of several thousand base pairs are
called LINEs (long interspersed elements). Most interspersed repeats are transposable elements, sequences that
can multiply and move (see Chapter 13).

DNA: The Chemical Nature of the Gene

The other major class of repetitive DNA is highly repetitive DNA. These short sequences, often less than 10 bp in
length, are present in hundreds of thousands to millions of
copies that are repeated in tandem and clustered in certain
regions of the chromosome, especially at centromeres and
telomeres. Highly repetitive DNA is sometimes called satellite DNA, because its percentages of the four bases differ
from those of other DNA sequences and, therefore, it separates as a satellite fraction when centrifuged at high speeds.
Highly repetitive DNA is rarely transcribed into RNA.
Although these sequences may contribute to centromere and
telomere function, most highly repetitive DNA has no
known function.
Direct sequencing of eukaryotic genomes also tell us a
lot about how genetic information is organized within chromosomes. We now know that the density of genes varies
greatly among and within chromosomes. For example,
human chromosome 19 has a high density of genes, with
about 26 genes per million base pairs. Chromosome 13, on
the other hand, has only about 6.5 genes per million base
pairs. Gene density can also vary within different regions of
the same chromosome: some parts of the long arm of chro-

213

mosome 13 have only 3 genes per million base pairs, whereas
other parts have almost 30 genes per million base pairs. And
the short arm of chromosome 13 contains almost no genes,
consisting entirely of heterochromatin.

Concepts
Eukaryotic DNA comprises three major classes: unique-sequence
DNA, moderately repetitive DNA, and highly repetitive DNA.
Unique-sequence DNA consists of sequences that exist in one or
only a few copies; moderately repetitive DNA consists of
sequences that may be several hundred base pairs in length and
is present in thousands to hundreds of thousands of copies.
Highly repetitive DNA consists of very short sequences repeated
in tandem and present in hundreds of thousands to millions of
copies. The density of genes varies greatly among and even within
chromosomes.

✔ Concept Check 11
Most of the genes that encode proteins are found in
a. unique-sequence DNA.

c. highly repetitive DNA.

b. moderately repetitive DNA.

d. all of the above.

Concepts Summary
• Genetic material must contain complex information, be






replicated accurately, and have the capacity to be translated
into the phenotype.
Evidence that DNA is the source of genetic information came
from the finding by Avery, MacLeod, and McCarty that
transformation depended on DNA and from the
demonstration by Hershey and Chase that viral DNA is
passed on to progeny phages.
James Watson and Francis Crick proposed a new model for
the three-dimensional structure of DNA in 1953.
A DNA nucleotide consists of a deoxyribose sugar, a phosphate
group, and a nitrogenous base. RNA consists of a ribose sugar,
a phosphate group, and a nitrogenous base.
The bases of a DNA nucleotide are of two types: purines
(adenine and guanine) and pyrimidines (cytosine and thymine).
RNA contains the pyrimidine uracil instead of thymine.

• Nucleotides are joined together by phosphodiester linkages in



a polynucleotide strand. Each polynucleotide strand has a free
phosphate group at its 5Ј end and a free hydroxyl group at its
3Ј end.
DNA consists of two nucleotide strands that wind around
each other to form a double helix. The sugars and phosphates
lie on the outside of the helix, and the bases are stacked in the
interior. The two strands are joined together by hydrogen
bonding between bases in each strand. The two strands are
antiparallel and complementary.

• DNA molecules can form a number of different secondary





structures, depending on the conditions in which the DNA is
placed and on its base sequence.
The structure of DNA has several important genetic
implications. Genetic information resides in the base sequence
of DNA, which ultimately specifies the amino acid sequence of
proteins. Complementarity of the bases on DNA’s two strands
allows genetic information to be replicated.
The central dogma of molecular biology proposes that
information flows in a one-way direction, from DNA to RNA
to protein. Exceptions to the central dogma are now known.
Chromosomes contain very long DNA molecules that are
tightly packed. Supercoiling results from strain produced
when rotations are added to a relaxed DNA molecule or
removed from it.

• A bacterial chromosome consists of a single, circular DNA


molecule that is bound to proteins and exists as a series of
large loops.
Each eukaryotic chromosome contains a single, long linear
DNA molecule that is bound to histone and nonhistone
chromosomal proteins. Euchromatin undergoes the normal
cycle of decondensation and condensation in the cell cycle.
Heterochromatin remains highly condensed throughout the
cell cycle.

• The nucleosome is a core of eight histone proteins and the
DNA that wraps around the core.